ID: 1019974975

View in Genome Browser
Species Human (GRCh38)
Location 7:4573885-4573907
Sequence GGTCCTCAGGCACCCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019974971_1019974975 -4 Left 1019974971 7:4573866-4573888 CCAAGGGTGGTCAGAAGGGGGTC No data
Right 1019974975 7:4573885-4573907 GGTCCTCAGGCACCCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019974975 Original CRISPR GGTCCTCAGGCACCCCAGGT GGG Intergenic
No off target data available for this crispr