ID: 1019979132

View in Genome Browser
Species Human (GRCh38)
Location 7:4608096-4608118
Sequence CTCTGCAATTAGTGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019979129_1019979132 19 Left 1019979129 7:4608054-4608076 CCAGATGATATCTGGGCGGAGGA No data
Right 1019979132 7:4608096-4608118 CTCTGCAATTAGTGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019979132 Original CRISPR CTCTGCAATTAGTGTGATCT TGG Intergenic
No off target data available for this crispr