ID: 1019983976

View in Genome Browser
Species Human (GRCh38)
Location 7:4641916-4641938
Sequence TTTATAAACAGAGCTCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019983976_1019983994 30 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983994 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
1019983976_1019983983 3 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983983 7:4641942-4641964 ACGGCGCGGCTGCCGGCGAGGGG No data
1019983976_1019983988 21 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983988 7:4641960-4641982 AGGGGTAACCCTAAGGGGAGTGG No data
1019983976_1019983982 2 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983982 7:4641941-4641963 CACGGCGCGGCTGCCGGCGAGGG No data
1019983976_1019983990 23 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983990 7:4641962-4641984 GGGTAACCCTAAGGGGAGTGGGG No data
1019983976_1019983981 1 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983981 7:4641940-4641962 ACACGGCGCGGCTGCCGGCGAGG No data
1019983976_1019983991 27 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983991 7:4641966-4641988 AACCCTAAGGGGAGTGGGGTCGG No data
1019983976_1019983987 16 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983987 7:4641955-4641977 CGGCGAGGGGTAACCCTAAGGGG No data
1019983976_1019983984 14 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983984 7:4641953-4641975 GCCGGCGAGGGGTAACCCTAAGG No data
1019983976_1019983980 -4 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983980 7:4641935-4641957 TAAACACACGGCGCGGCTGCCGG No data
1019983976_1019983989 22 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983989 7:4641961-4641983 GGGGTAACCCTAAGGGGAGTGGG No data
1019983976_1019983986 15 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983986 7:4641954-4641976 CCGGCGAGGGGTAACCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019983976 Original CRISPR TTTATAAACAGAGCTCCCGG CGG (reversed) Intergenic