ID: 1019983993

View in Genome Browser
Species Human (GRCh38)
Location 7:4641969-4641991
Sequence CCTCCGACCCCACTCCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019983993_1019984001 6 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019984001 7:4641998-4642020 GTCAGCGGGCGCGGGGTCGCCGG No data
1019983993_1019983996 -9 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019983996 7:4641983-4642005 GGTCGGAGGTCAGAGGTCAGCGG No data
1019983993_1019983997 -8 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019983997 7:4641984-4642006 GTCGGAGGTCAGAGGTCAGCGGG No data
1019983993_1019983998 -3 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019983998 7:4641989-4642011 AGGTCAGAGGTCAGCGGGCGCGG No data
1019983993_1019983999 -2 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019983999 7:4641990-4642012 GGTCAGAGGTCAGCGGGCGCGGG No data
1019983993_1019984002 18 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019984002 7:4642010-4642032 GGGGTCGCCGGCTGTGAGACCGG No data
1019983993_1019984000 -1 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019984000 7:4641991-4642013 GTCAGAGGTCAGCGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019983993 Original CRISPR CCTCCGACCCCACTCCCCTT AGG (reversed) Intergenic