ID: 1019983994

View in Genome Browser
Species Human (GRCh38)
Location 7:4641969-4641991
Sequence CCTAAGGGGAGTGGGGTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019983985_1019983994 -8 Left 1019983985 7:4641954-4641976 CCGGCGAGGGGTAACCCTAAGGG No data
Right 1019983994 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
1019983977_1019983994 27 Left 1019983977 7:4641919-4641941 CCGGGAGCTCTGTTTATAAACAC No data
Right 1019983994 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
1019983976_1019983994 30 Left 1019983976 7:4641916-4641938 CCGCCGGGAGCTCTGTTTATAAA No data
Right 1019983994 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019983994 Original CRISPR CCTAAGGGGAGTGGGGTCGG AGG Intergenic
No off target data available for this crispr