ID: 1019983995

View in Genome Browser
Species Human (GRCh38)
Location 7:4641976-4641998
Sequence GGAGTGGGGTCGGAGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019983985_1019983995 -1 Left 1019983985 7:4641954-4641976 CCGGCGAGGGGTAACCCTAAGGG No data
Right 1019983995 7:4641976-4641998 GGAGTGGGGTCGGAGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019983995 Original CRISPR GGAGTGGGGTCGGAGGTCAG AGG Intergenic
No off target data available for this crispr