ID: 1019983995 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:4641976-4641998 |
| Sequence | GGAGTGGGGTCGGAGGTCAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019983985_1019983995 | -1 | Left | 1019983985 | 7:4641954-4641976 | CCGGCGAGGGGTAACCCTAAGGG | No data | ||
| Right | 1019983995 | 7:4641976-4641998 | GGAGTGGGGTCGGAGGTCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019983995 | Original CRISPR | GGAGTGGGGTCGGAGGTCAG AGG | Intergenic | ||