ID: 1019983998

View in Genome Browser
Species Human (GRCh38)
Location 7:4641989-4642011
Sequence AGGTCAGAGGTCAGCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019983992_1019983998 -2 Left 1019983992 7:4641968-4641990 CCCTAAGGGGAGTGGGGTCGGAG No data
Right 1019983998 7:4641989-4642011 AGGTCAGAGGTCAGCGGGCGCGG No data
1019983985_1019983998 12 Left 1019983985 7:4641954-4641976 CCGGCGAGGGGTAACCCTAAGGG No data
Right 1019983998 7:4641989-4642011 AGGTCAGAGGTCAGCGGGCGCGG No data
1019983993_1019983998 -3 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019983998 7:4641989-4642011 AGGTCAGAGGTCAGCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019983998 Original CRISPR AGGTCAGAGGTCAGCGGGCG CGG Intergenic
No off target data available for this crispr