ID: 1019983999

View in Genome Browser
Species Human (GRCh38)
Location 7:4641990-4642012
Sequence GGTCAGAGGTCAGCGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019983993_1019983999 -2 Left 1019983993 7:4641969-4641991 CCTAAGGGGAGTGGGGTCGGAGG No data
Right 1019983999 7:4641990-4642012 GGTCAGAGGTCAGCGGGCGCGGG No data
1019983985_1019983999 13 Left 1019983985 7:4641954-4641976 CCGGCGAGGGGTAACCCTAAGGG No data
Right 1019983999 7:4641990-4642012 GGTCAGAGGTCAGCGGGCGCGGG No data
1019983992_1019983999 -1 Left 1019983992 7:4641968-4641990 CCCTAAGGGGAGTGGGGTCGGAG No data
Right 1019983999 7:4641990-4642012 GGTCAGAGGTCAGCGGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019983999 Original CRISPR GGTCAGAGGTCAGCGGGCGC GGG Intergenic