ID: 1019984587

View in Genome Browser
Species Human (GRCh38)
Location 7:4646459-4646481
Sequence TATGTTATATGGAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019984582_1019984587 -5 Left 1019984582 7:4646441-4646463 CCATTGCTCAGATCTGGTTATGT No data
Right 1019984587 7:4646459-4646481 TATGTTATATGGAAGGGGCAAGG No data
1019984578_1019984587 24 Left 1019984578 7:4646412-4646434 CCAGTGGAACATGGCAGAGGGGG No data
Right 1019984587 7:4646459-4646481 TATGTTATATGGAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019984587 Original CRISPR TATGTTATATGGAAGGGGCA AGG Intergenic
No off target data available for this crispr