ID: 1019993133

View in Genome Browser
Species Human (GRCh38)
Location 7:4706405-4706427
Sequence AACAGCAAGGGGAGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019993124_1019993133 -8 Left 1019993124 7:4706390-4706412 CCTTCCCTCCAGCTAAACAGCAA 0: 1
1: 0
2: 2
3: 21
4: 286
Right 1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG No data
1019993123_1019993133 22 Left 1019993123 7:4706360-4706382 CCTAAGTTAGGAGTTTATATCTG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG No data
1019993122_1019993133 23 Left 1019993122 7:4706359-4706381 CCCTAAGTTAGGAGTTTATATCT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019993133 Original CRISPR AACAGCAAGGGGAGGTGGTC AGG Intronic
No off target data available for this crispr