ID: 1019994541

View in Genome Browser
Species Human (GRCh38)
Location 7:4715652-4715674
Sequence CCTGCCAGTCAGTCACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019994541_1019994547 23 Left 1019994541 7:4715652-4715674 CCCTGCTGTGACTGACTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1019994547 7:4715698-4715720 TGTAGTGCACGCCGTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019994541 Original CRISPR CCTGCCAGTCAGTCACAGCA GGG (reversed) Intronic
900946792 1:5835314-5835336 TCTGCCTGTCAGGCACGGCATGG - Intergenic
901001889 1:6153000-6153022 TCTGCCAGTCAACCCCAGCAAGG + Intronic
901892732 1:12281714-12281736 CCTGTCAGTCATTCACATAATGG + Intronic
903439793 1:23379103-23379125 CCTTCCAGGAAGTCACAGCCTGG - Intergenic
904350874 1:29905418-29905440 CCTGCAACCCAGGCACAGCATGG - Intergenic
905917740 1:41697551-41697573 CCTGCCAGCCAGTCCCACCTTGG - Intronic
908233572 1:62129548-62129570 GCTGCCTCTCAGTCACTGCATGG - Intronic
908314516 1:62919806-62919828 CCTGTAAGTCAGCCACAGCGAGG + Intergenic
909477165 1:76094059-76094081 CCTCCCTGACAGTCACTGCAGGG + Intronic
910140782 1:84025297-84025319 ACTCCCAGTCACTCATAGCAGGG - Intergenic
910426734 1:87126166-87126188 CCTGCCATTCACTAGCAGCATGG + Intronic
915526594 1:156479951-156479973 CCTGCCTGCCAGTCCCACCAAGG + Intronic
916418032 1:164610717-164610739 CCTGCCAGCCCATCACAGCAAGG - Intronic
916785841 1:168086539-168086561 CCTGCCACTCACTCATGGCAGGG + Intronic
917287773 1:173439667-173439689 GGTGCCAGTCAGTGACACCAGGG + Intergenic
917537605 1:175885684-175885706 CCTGGCAGTCAATCAAACCAGGG - Intergenic
917622600 1:176812039-176812061 CCTACCAGGAAGTCACAGCACGG - Intronic
922516308 1:226210692-226210714 CATGCCAATCAGTCACACCTAGG - Intergenic
922533003 1:226358627-226358649 TCTGCCATTCAGCCTCAGCATGG - Intergenic
922974354 1:229771295-229771317 CCTGCCTGTCAGACTCAGCCTGG - Intergenic
1067526220 10:47040298-47040320 CCTGCCCCACAGCCACAGCAGGG + Intergenic
1070457403 10:76630938-76630960 CCGGCCTGTCAGTCAGAACAGGG - Intergenic
1070824140 10:79381050-79381072 GCTGCCAGTCGGGCCCAGCAAGG - Intergenic
1070878661 10:79840408-79840430 CCAGACAGACAGTCACTGCATGG + Intergenic
1071631766 10:87224497-87224519 CCAGACAGACAGTCACTGCATGG + Intergenic
1071645220 10:87356718-87356740 CCAGACAGACAGTCACTGCATGG + Intergenic
1072230552 10:93410832-93410854 CCTGTCAGTCATTCACATCCTGG + Intronic
1073466260 10:103696152-103696174 CCCACCATTCAGTCACAGCCTGG - Intronic
1073649034 10:105339339-105339361 TCTGCAAGTCAGTAACTGCATGG - Intergenic
1075712996 10:124540673-124540695 CCTGCCTGTGAGTCAAACCATGG - Intronic
1076110512 10:127855960-127855982 CCTGTCAGACAGACACAGCAGGG + Intergenic
1077200005 11:1302037-1302059 CCAGCCCCTCAGACACAGCAGGG - Intronic
1077334647 11:1997908-1997930 CCTGCCGGCCAATCAGAGCAGGG + Intergenic
1077423189 11:2462548-2462570 CCTGCCACTCAGTAACAGGTGGG - Intronic
1077782897 11:5351377-5351399 CCTGACTTTCAGTGACAGCAAGG - Intronic
1078722589 11:13898107-13898129 CCTGCCAGCCAGGCCCTGCAAGG - Intergenic
1078799203 11:14625565-14625587 TCTCCTAGTCAGTAACAGCAAGG + Intronic
1083326280 11:61874558-61874580 CCCGCCAGTCATTCCCAGTAGGG + Intronic
1086400352 11:86456495-86456517 CCTGTCAGTCACCCAAAGCAAGG + Intronic
1090235005 11:125140522-125140544 CCTGCCAGTCTCCCACAGCCAGG + Intergenic
1202817630 11_KI270721v1_random:53090-53112 CCTGCCGGCCAATCAGAGCAGGG + Intergenic
1091757154 12:3061385-3061407 TCTGTGAGTCAGTCTCAGCATGG - Intergenic
1094095106 12:26694894-26694916 CCTGGCAGTCAGACAGAGAAGGG + Intronic
1100301231 12:93309830-93309852 GCTGCAACGCAGTCACAGCAAGG + Intergenic
1100377386 12:94030043-94030065 CATGCTTGCCAGTCACAGCATGG - Intergenic
1101901216 12:108792500-108792522 CCGGCCAGACAGCCCCAGCAAGG - Exonic
1102599382 12:114017669-114017691 CCCACCAGTCAGTCACTGCATGG - Intergenic
1104686491 12:130788290-130788312 CCTGCCAGTCATTTAGAGCCTGG + Intergenic
1106763346 13:32889941-32889963 CCTGTCAGTCAGCCACTCCAGGG - Intergenic
1107837617 13:44424212-44424234 CCTGTCAGTCATTCACAGAATGG + Intergenic
1118697127 14:68396050-68396072 CCTGACAGGCAGCCACAGCCAGG - Intronic
1118860355 14:69658262-69658284 GATGGCAGTCAGGCACAGCAGGG - Intronic
1119531153 14:75362232-75362254 CCCGCCAGTCAGTCTGACCAGGG + Intergenic
1121015442 14:90546204-90546226 CCTGACAGCCAGACACAGCCAGG - Intronic
1121608882 14:95262012-95262034 CCTGTCAGCCAGGCACAGCCAGG - Intronic
1122660790 14:103293639-103293661 CCTGGCAGCCAGACACAGGATGG - Intergenic
1132147220 15:99436184-99436206 ACTGCCAATCAGTCATTGCAGGG + Intergenic
1132605252 16:791009-791031 CCTGCCAGCGAGTGACCGCAAGG - Intronic
1135282524 16:21165032-21165054 CCAGCCAGTCTGTCCCAGGAGGG - Intronic
1135465626 16:22682183-22682205 TTTGACAGTGAGTCACAGCAAGG - Intergenic
1137599230 16:49744608-49744630 CCCCCCAGCCAGTGACAGCAAGG + Intronic
1137879409 16:52031107-52031129 TTTCCCAGTCAGTCCCAGCAAGG + Intronic
1143369998 17:6433710-6433732 CCCACCAGCCAGCCACAGCATGG + Intronic
1143894574 17:10126060-10126082 CCTGCCAGGGACCCACAGCAGGG + Intronic
1146945290 17:36869455-36869477 TCAGTCAGTCACTCACAGCATGG + Intergenic
1147675204 17:42200534-42200556 CCTGCCAGGACTTCACAGCAGGG + Exonic
1148264604 17:46215650-46215672 CCAGCCAGTCACTCAAATCAGGG - Intronic
1148701114 17:49587584-49587606 CAGGCCAGTGAGGCACAGCAGGG - Intergenic
1150355407 17:64479918-64479940 CCTTCCACTCAGTCTCAGAATGG + Intronic
1152084123 17:78207049-78207071 CCGGGCAGACAGACACAGCAAGG - Exonic
1152786956 17:82253339-82253361 CCTGCCCCTCAGCCACAGCAGGG + Intronic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1153818635 18:8813074-8813096 CCTGGCAGACAGTCACAGCCTGG + Exonic
1155957003 18:31962674-31962696 TCTCCCACTCAGTCACAGCAGGG - Intergenic
1156211856 18:34952963-34952985 CTCCCCAGTCAGTCACAGGAGGG - Intergenic
1156661121 18:39347810-39347832 CCTTGATGTCAGTCACAGCACGG + Intergenic
1157092071 18:44648479-44648501 CCTGCCACCCAGTTCCAGCATGG - Intergenic
1161775315 19:6258869-6258891 CCTTCCAGTCAGTCTGGGCAAGG - Intronic
1164787157 19:30942683-30942705 CTTTCCAGTCAGCTACAGCAAGG + Intergenic
1165356979 19:35310411-35310433 CGTGCCAATCAGTCAGTGCAAGG + Intronic
1168404177 19:56102360-56102382 CCTGACATGCAGACACAGCAAGG + Intronic
925090188 2:1148881-1148903 CCTGCCAGGCTGTGACACCAGGG - Intronic
926119657 2:10235138-10235160 CTGGCCAGTCAGGCACAGGAGGG + Intergenic
929429283 2:41872950-41872972 CATGCCAAGCAGTCACAGAAAGG + Intergenic
931607544 2:64067121-64067143 CCTGCCAGACAGACATACCAAGG + Intergenic
932695292 2:73951224-73951246 CCAGCCAGAGAGTCACAGAATGG - Intronic
933051683 2:77609958-77609980 CTGCCCAGTAAGTCACAGCAGGG - Intergenic
938187518 2:129244829-129244851 CCTGCCAGTCAGTGACAGAGAGG - Intergenic
938727701 2:134121554-134121576 CCTGGCAGTCGGTCCCAGGAGGG - Intronic
939582061 2:143962107-143962129 CCTTCCAGTCAGTTATACCATGG + Intronic
941763558 2:169271125-169271147 CAGCACAGTCAGTCACAGCATGG + Intronic
942228274 2:173835840-173835862 CTTGCCACTTAGTGACAGCAGGG + Intergenic
943733499 2:191328467-191328489 ACTGCCAGTGTGACACAGCAGGG - Intronic
943793546 2:191963547-191963569 TCTGCCAGTTAGTCACTTCAGGG - Intronic
947587254 2:231364177-231364199 CCTGTCAGTCCTTCTCAGCATGG + Intronic
948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG + Intronic
948827474 2:240579615-240579637 CTTGCCAGGCAGGCACAGCTAGG + Exonic
948955928 2:241291331-241291353 CCTGCCTGCCTGTCACAGGAGGG - Intronic
1169501776 20:6167415-6167437 GCTCCCAGTGAGTGACAGCATGG + Intergenic
1169902254 20:10565470-10565492 CCGGGCAGTCAGTCTCTGCAGGG - Intronic
1170005607 20:11665557-11665579 CCTGTCAGGCGGACACAGCAAGG - Intergenic
1170056922 20:12215749-12215771 CCTGCCTCACAGTCACAACATGG - Intergenic
1170817269 20:19724321-19724343 CCTGGCAGTGACTCTCAGCAAGG - Intergenic
1172039005 20:32030888-32030910 ACAGCCAGTGAGTGACAGCAGGG + Intronic
1173912704 20:46682082-46682104 TCTGGCAGTCAGTGACAGCTGGG + Intronic
1176171104 20:63696699-63696721 CATGTCGGTCAGGCACAGCAGGG + Exonic
1176289096 21:5034836-5034858 ACTGCCAGTCACCCACAGGAAGG + Intronic
1178517704 21:33262965-33262987 CCTGACAGTCAGTCCATGCATGG - Exonic
1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG + Intergenic
1179868139 21:44228768-44228790 ACTGCCAGTCACCCACAGGAAGG - Intronic
1179900868 21:44393184-44393206 CCTGACATTGAGTCACTGCAAGG - Intronic
1183380624 22:37488899-37488921 CCTGCCAGTCTGTCACCACTGGG - Intergenic
951497007 3:23340708-23340730 CCTGTAAGTCAGTCAAAACAGGG + Intronic
953579229 3:44138337-44138359 CTTGTCAGTCAGCCCCAGCATGG - Intergenic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
958578656 3:95987749-95987771 CTTGCCATTTAGTCAGAGCAGGG + Intergenic
960060693 3:113317440-113317462 CCTGCCTGCCAGTCACTGCCGGG + Intronic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
961811693 3:129525629-129525651 CCAGCCAGCCATTCACACCATGG - Intergenic
964404183 3:156331142-156331164 CAAGCCAGTCAGTCACTTCAAGG - Intronic
965431284 3:168592310-168592332 CCTGCAACTCAGTCACAGTTAGG - Intergenic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
969981548 4:11161800-11161822 CCTGCCACTCAAGCCCAGCAAGG + Intergenic
975236499 4:72003168-72003190 CCTGGCACTTAGTAACAGCATGG - Intergenic
975807704 4:78130012-78130034 GCTGCCAGTCAGACACAGTAAGG - Intronic
977162996 4:93659626-93659648 TCTGCCAATCATTCACTGCAGGG - Intronic
979609086 4:122670601-122670623 CCTGCCAGTCCCTCACCGCAGGG - Intergenic
981410302 4:144422393-144422415 TCTGCTCCTCAGTCACAGCAAGG - Intergenic
984657425 4:182333968-182333990 ACTGCCAGTCAGCTACGGCAAGG - Intronic
985105562 4:186496221-186496243 CCAGCAAGTCAGTGTCAGCAAGG + Intronic
987438370 5:17925693-17925715 CCTGCCACACAATCACAGCAAGG + Intergenic
988509821 5:31855441-31855463 CCTGCCCGTCACACACAGCCGGG - Intronic
990818794 5:59814502-59814524 CCTGCCAGTGAGTCACATGCAGG + Intronic
994789501 5:104205957-104205979 AATCCCAGACAGTCACAGCAGGG + Intergenic
996338630 5:122412054-122412076 CCTGCCTGCCAGTCACGTCAAGG + Intronic
997067317 5:130577039-130577061 ACTGCAGGTCAGTCACAGGATGG - Intergenic
997444315 5:133930215-133930237 CCCAGCAGTGAGTCACAGCAGGG + Intergenic
998095908 5:139395321-139395343 CCTGCCTGTCAGCCAAAGCTTGG - Exonic
999759150 5:154687007-154687029 CCGACCCCTCAGTCACAGCATGG + Intergenic
1000426208 5:161093815-161093837 CCTGCTGGTCAGTCACAGGGTGG - Intergenic
1001287018 5:170431218-170431240 CCTGACAGGCAGTGGCAGCAAGG - Intronic
1002490393 5:179572159-179572181 GCTTCCAGTCAGTCGCAGCTCGG + Intronic
1003338367 6:5196235-5196257 CCTGCAAGACAGTCACATGAGGG - Intronic
1004147047 6:13077659-13077681 ACTGCCAGTCAGTCACCCAAAGG - Intronic
1006814605 6:36841282-36841304 CCTGACAGCCAGGCACAGCTGGG + Intergenic
1007754278 6:44088843-44088865 CCTTACAACCAGTCACAGCAAGG + Intergenic
1009278418 6:61716004-61716026 CCTGTCAGTGGGTGACAGCATGG - Intronic
1011825001 6:91295450-91295472 CCTACCACTCAGGCACAGGAGGG - Intergenic
1014754451 6:125287975-125287997 TGGGCCTGTCAGTCACAGCATGG + Intronic
1017879353 6:158548961-158548983 CCTGCCTCTCTGGCACAGCAAGG - Intronic
1018798785 6:167207150-167207172 CCTTCCAGTCAGTGACAGCCAGG - Intergenic
1019161833 6:170074094-170074116 CCTGCATGTGAGTCACTGCAGGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019906171 7:4066795-4066817 CCTGCGACTCAGGGACAGCAGGG - Intronic
1019994541 7:4715652-4715674 CCTGCCAGTCAGTCACAGCAGGG - Intronic
1020277241 7:6632150-6632172 CCTGCCAGTGAGACACACGAAGG + Intergenic
1021786667 7:24159092-24159114 ACTTCCAGTCAGTCTCAGCAGGG + Intergenic
1023519325 7:41034934-41034956 CCTTCCAGACCGTCTCAGCATGG + Intergenic
1023882621 7:44328994-44329016 CCAGGCACTCAGTCACATCAGGG + Intronic
1024759053 7:52572347-52572369 CTTGCCATTCAGCCAAAGCATGG - Intergenic
1025870982 7:65434073-65434095 CCTGCCACACAGTCAAAGAAAGG + Intergenic
1026678284 7:72446623-72446645 CCTGCCACTCGGTCAGAACATGG - Intronic
1027559412 7:79708435-79708457 TCTTCCAGTTAGTCACAGAAAGG - Intergenic
1036570116 8:9972969-9972991 CCTGCCAGTCTGTGCCAGAATGG - Intergenic
1037505831 8:19528316-19528338 CTTGCCTGACAGTCACGGCAAGG + Intronic
1039922934 8:41905977-41905999 CCTGACAGGCTGCCACAGCAAGG - Intergenic
1040419244 8:47223902-47223924 CCTGCCACTCAGTACCAGCAGGG + Intergenic
1040957134 8:52990895-52990917 CCTTCCAGTCTGTCACAGTAAGG - Intergenic
1042754560 8:72196423-72196445 CCTTCCACTCACCCACAGCAAGG - Intergenic
1043978750 8:86614320-86614342 ACTACCTGTCAGTCACAGCAAGG + Intronic
1046785507 8:118261656-118261678 TCTGCCAGTCACTGAGAGCATGG - Intronic
1048594679 8:135853885-135853907 CCTGCCACTTAGTGGCAGCATGG - Intergenic
1049693114 8:143971405-143971427 CCAGCCAGCCAGTGACGGCAAGG - Intronic
1049985591 9:947969-947991 CCTCCCAGTCAGCAGCAGCAAGG - Intronic
1052498722 9:29261161-29261183 CCTGCCATTCTGTGACAGCTAGG + Intergenic
1052996669 9:34554870-34554892 AGTGCCAGTGAGTCACAGAATGG + Intronic
1056551881 9:87659349-87659371 CTAGCAAGTCAGGCACAGCAGGG - Intronic
1057064306 9:92034216-92034238 TGGGCCAGGCAGTCACAGCAGGG - Intronic
1058437159 9:104973507-104973529 CCTGAGAGTCTGTCACAGCGTGG + Intergenic
1061821174 9:133227905-133227927 GCTGGCAGACACTCACAGCATGG + Intergenic
1061834275 9:133318459-133318481 GCTGGCAGACACTCACAGCATGG - Intergenic
1062049597 9:134440404-134440426 CTTCACAGTCAGTCACAGGAAGG - Intronic
1062238082 9:135522171-135522193 GCTGGCAGACACTCACAGCATGG - Exonic
1062270626 9:135706723-135706745 CCTGGCTGTCTGTCACAGCTGGG - Intronic
1062581596 9:137231388-137231410 CCTTCCAGTCAGGACCAGCAAGG + Intronic
1190039718 X:47060466-47060488 GGTGCCAGTCAGTCAAGGCAGGG + Exonic
1191965954 X:66758434-66758456 CCTGACAGACGGTCAAAGCAGGG - Intergenic
1192385975 X:70670288-70670310 ACAGCCAGGAAGTCACAGCATGG + Intronic
1197674590 X:129315592-129315614 TCTGCCAGCCAGTCAGATCAAGG + Intergenic
1199929112 X:152500469-152500491 CCTGCCAGCTTTTCACAGCAAGG - Intergenic
1200528758 Y:4306874-4306896 CCTGCAAGTGACTCAAAGCAAGG - Intergenic