ID: 1019995664

View in Genome Browser
Species Human (GRCh38)
Location 7:4722867-4722889
Sequence GCAGAATTGGCATCCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019995655_1019995664 8 Left 1019995655 7:4722836-4722858 CCATCCCTCTCTCGTTTGGGCTC 0: 1
1: 0
2: 1
3: 26
4: 267
Right 1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG No data
1019995657_1019995664 4 Left 1019995657 7:4722840-4722862 CCCTCTCTCGTTTGGGCTCCGGT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG No data
1019995652_1019995664 14 Left 1019995652 7:4722830-4722852 CCTTCTCCATCCCTCTCTCGTTT 0: 1
1: 0
2: 47
3: 184
4: 1353
Right 1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG No data
1019995658_1019995664 3 Left 1019995658 7:4722841-4722863 CCTCTCTCGTTTGGGCTCCGGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019995664 Original CRISPR GCAGAATTGGCATCCAGGTG AGG Intronic
No off target data available for this crispr