ID: 1019997899

View in Genome Browser
Species Human (GRCh38)
Location 7:4736712-4736734
Sequence CCAGTTCAAAACCTGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019997899_1019997902 -5 Left 1019997899 7:4736712-4736734 CCCATAATCAGGTTTTGAACTGG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1019997902 7:4736730-4736752 ACTGGAAAGCACCTTTGAGATGG 0: 1
1: 0
2: 2
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019997899 Original CRISPR CCAGTTCAAAACCTGATTAT GGG (reversed) Intronic
903177396 1:21589237-21589259 CCAGTTCAAATCCTGACCACTGG - Intergenic
906020374 1:42623061-42623083 CCATTTTAAAATCAGATTATTGG + Intronic
906123685 1:43412805-43412827 CCATTTTAAAATCAGATTATTGG - Intronic
906863719 1:49391846-49391868 CAAGTTCAAAACCTCATGGTTGG - Intronic
911659320 1:100482548-100482570 CCTGTGCAAATCCTGATCATAGG + Intronic
912215136 1:107601272-107601294 CCAGTTCAAAAGCTAAGGATGGG - Intronic
914416403 1:147487382-147487404 GCAGTTCAAAACCTGAACCTTGG + Intergenic
915563306 1:156700169-156700191 CCAGGTCCAAACCTGCTTCTTGG + Intronic
916900203 1:169214450-169214472 CCATTTCAAAAAATGATAATAGG + Intronic
917703056 1:177600662-177600684 CCAGTGCTAAACCTGACTCTCGG + Intergenic
918214434 1:182381029-182381051 CCAGTTCAAGACCTCACTTTGGG + Intergenic
919311416 1:195915221-195915243 CCAGTAGAAAACCTTATGATGGG - Intergenic
1065304584 10:24356287-24356309 CCAGTACAAAGCCTGATGCTGGG + Intronic
1065825892 10:29571219-29571241 TCTGTTCATAATCTGATTATGGG - Intronic
1065951467 10:30655438-30655460 TCTGTTCATAATCTGATTATGGG + Intergenic
1066686003 10:37982332-37982354 CCAATTCAAAAACTGTTTCTGGG + Intergenic
1068269467 10:54701412-54701434 CCAGCTAAAAACATGATTAAAGG + Intronic
1068837777 10:61572913-61572935 CAAGAACATAACCTGATTATTGG - Intergenic
1069838477 10:71324636-71324658 GGAGTTCAAAACCTGATTACAGG + Intronic
1074358255 10:112804589-112804611 CCAGGTAAATACCAGATTATGGG + Intronic
1075548061 10:123370463-123370485 TGAGTTCAAAACCTCATTCTGGG + Intergenic
1085455765 11:76664523-76664545 CCATTTCACCACCTGATCATGGG + Intronic
1089448971 11:118577833-118577855 CATGTTCAAAAACTAATTATAGG - Intronic
1092061425 12:5554088-5554110 TCAGTTCCACACCTGATTATTGG - Intronic
1095691285 12:45092070-45092092 CCACTTCAAAACCAGAAAATAGG + Intergenic
1096748024 12:53741178-53741200 CCAATTCAAACCCTGATTGAAGG - Intergenic
1099967642 12:89467189-89467211 CCAGTCCAAAACATGGTTTTGGG - Intronic
1105655202 13:22429156-22429178 CCATTTCAAAACTTAATTTTTGG + Intergenic
1108406935 13:50113759-50113781 CCATTTAAAAACATGATTCTAGG + Intronic
1114708985 14:24758344-24758366 CCAGTTGATATCCTGATTTTTGG - Intergenic
1114980306 14:28156463-28156485 CCTGGTCAAAACCTTATTTTTGG + Intergenic
1116349813 14:43847047-43847069 TCAGATCAAAATGTGATTATAGG + Intergenic
1118686940 14:68300657-68300679 CAAATTCAAAGGCTGATTATTGG - Intronic
1121222657 14:92298469-92298491 CTGTTTCAAGACCTGATTATGGG + Intergenic
1123784754 15:23659377-23659399 CCGTTTTTAAACCTGATTATTGG - Intergenic
1129866915 15:78915860-78915882 GCAGTTTAATACATGATTATTGG + Intergenic
1134044088 16:11088713-11088735 CCAGATCAAAACCTTAGCATTGG + Intronic
1141011093 16:80400307-80400329 CCATTTTAAAATCAGATTATTGG - Intergenic
1155524311 18:26700889-26700911 ACACTTCAGAACCTGATGATGGG + Intergenic
1158226341 18:55205423-55205445 CACGTTCACAACCTGATGATGGG - Intergenic
1160272461 18:77399585-77399607 TCAGTGCAATCCCTGATTATAGG + Intergenic
1162102808 19:8350453-8350475 CAAGATAAAAACCTGATTATTGG + Intronic
1163788247 19:19289082-19289104 GCAGTTGAAAATCTGAATATAGG - Intronic
1165455661 19:35909196-35909218 CTAGTCAAAAACCTGATTTTGGG - Intergenic
929296717 2:40256722-40256744 CCAGCTCAAAATCTGGTGATAGG - Intronic
929629786 2:43447581-43447603 GCACTGCAAAAACTGATTATAGG + Intronic
930664918 2:54092452-54092474 CCTGTTCCAAGGCTGATTATAGG - Intronic
931731058 2:65153809-65153831 CCAGTCCACAACCTGAGGATTGG + Intergenic
931901408 2:66792715-66792737 CTAGATCAAAATCTGAGTATAGG - Intergenic
933532839 2:83532120-83532142 CCAATTCAAAATGTGATTTTAGG + Intergenic
935697122 2:105779705-105779727 TCAATTCAAAAGCTGATTAGTGG - Intronic
936826252 2:116585314-116585336 AAAGTTCAAAACCTGTTTAGTGG - Intergenic
940131801 2:150390067-150390089 CCAGATCAAAACCAGTTTCTGGG + Intergenic
941516284 2:166483488-166483510 CCACTTCCAAACCTTCTTATAGG - Intronic
941591109 2:167421963-167421985 GAAATTCAAAACCTGATTTTAGG - Intergenic
942936824 2:181567427-181567449 ACAGTTCTAAAGCTCATTATTGG - Intronic
944954437 2:204791726-204791748 CCCTTGCAAAATCTGATTATGGG - Intronic
944957126 2:204824805-204824827 TAAGCTCAAAACCTGATTGTAGG - Intronic
945664505 2:212724117-212724139 CCAGTTCAACAGGTGATTTTGGG - Intergenic
945741841 2:213672977-213672999 CAAGTTAAAGACCTGATCATTGG - Intronic
946660660 2:221995646-221995668 CCATTTTAAAATGTGATTATTGG + Intergenic
947297985 2:228654438-228654460 TCAGTTCAAAACCCGAATCTAGG - Intergenic
1170418902 20:16173015-16173037 CCTGTTCACAACCTGTTTAAAGG + Intergenic
1176689722 21:9890504-9890526 CCAGTTAATAACCTTATAATGGG - Intergenic
1178550973 21:33539151-33539173 CCACTTTAAAACATGATTACCGG + Exonic
1179989029 21:44936604-44936626 CCACTTGAAACCATGATTATGGG - Intronic
953077526 3:39583661-39583683 CCAGTTAAACATCAGATTATCGG - Intergenic
959729777 3:109588628-109588650 CCCATTCAAAACCTCAATATCGG + Intergenic
959855502 3:111151251-111151273 CTCATTCAAAACCTGTTTATCGG - Intronic
961046155 3:123709438-123709460 CTGGTACAAAACCAGATTATGGG - Intronic
962826075 3:139101895-139101917 CCAGTTCAAATCTTGGTTGTTGG - Intronic
964314609 3:155429912-155429934 CCAGTACAAGAAATGATTATAGG - Intronic
967542872 3:190689984-190690006 CCACCTCAAAACATGATTATAGG + Intergenic
967581712 3:191165521-191165543 TTAGTTCAAGACATGATTATTGG - Intergenic
971039912 4:22740459-22740481 CCATTTCAAAGCTTGATTATAGG + Intergenic
975590730 4:75997197-75997219 CCAGTTCATAATCTTATTAATGG + Intergenic
975802473 4:78075484-78075506 TGAGTTCAATATCTGATTATAGG - Intronic
976200246 4:82570771-82570793 CCAGTTCAAAACCACACTCTAGG + Intergenic
977761926 4:100747998-100748020 CCAGCTAAAAACCTCATGATAGG + Intronic
980353133 4:131708369-131708391 CCAGTTAATAACCTTATAATGGG - Intergenic
981031655 4:140131581-140131603 CCATTTCAAAAACTAATTCTGGG + Intronic
983628942 4:169829650-169829672 CCAGTTAACAACATGATGATAGG + Intergenic
984528970 4:180892109-180892131 TCATTTCAAAAGCTTATTATAGG + Intergenic
985483970 5:138676-138698 CCAGTGCAAAACATGATTGGTGG + Intergenic
992966348 5:82004852-82004874 CCAGTCCAAAAACTGTTTACTGG - Intronic
998936659 5:147236226-147236248 CCAGTTAATAATCTGATAATCGG + Intronic
1003544206 6:7044672-7044694 CCAGTTAAAGACTTCATTATTGG + Intergenic
1009033016 6:58082819-58082841 CCAGCTAAAAACATGATGATAGG + Intergenic
1009208633 6:60834587-60834609 CCAGCTGAAAACATGATGATAGG + Intergenic
1009912118 6:69943224-69943246 CCATTTTAAAATCAGATTATTGG + Intronic
1010326083 6:74563381-74563403 ACAATTCTAAAGCTGATTATAGG - Intergenic
1011078399 6:83462731-83462753 CCAGCCCAAAACCTGAGTATAGG - Intergenic
1012501004 6:99888170-99888192 TCAGTTCAAAACTTGACAATGGG + Intergenic
1013851271 6:114519130-114519152 CATGTTCAGAACGTGATTATTGG - Intergenic
1016930706 6:149405075-149405097 CCATTTTAAAATCTGGTTATTGG - Intronic
1017273608 6:152539054-152539076 CCTGATCAAAACCTGCTTGTAGG + Intronic
1019966761 7:4505921-4505943 CCAGTTAAAATTCAGATTATTGG + Intergenic
1019997899 7:4736712-4736734 CCAGTTCAAAACCTGATTATGGG - Intronic
1022725870 7:32981050-32981072 CCAGTTATAAACCTCATTATGGG + Intronic
1024054980 7:45654262-45654284 CCTGTTCAAAATCTGATTCACGG - Intronic
1025047728 7:55706599-55706621 CCAGTTATAAACCTCATTATGGG - Intergenic
1027995098 7:85415677-85415699 TCAGTAAAAAAGCTGATTATGGG + Intergenic
1028076485 7:86522449-86522471 CCAGGACAAAACATGTTTATAGG + Intergenic
1028094234 7:86740547-86740569 CCAATTCAAAACCTAATTTCAGG + Intronic
1030950987 7:115790274-115790296 AGAGTGCGAAACCTGATTATCGG - Intergenic
1032320664 7:130883793-130883815 CCAGTCTAAGACCTGAATATGGG + Intergenic
1033614968 7:143005161-143005183 ACAGTTTAACACCTGATAATGGG + Intergenic
1038377455 8:27056214-27056236 CAAATTCAAAACCTGGTTCTTGG + Intergenic
1039146912 8:34457667-34457689 TTAGTTCAAAATCTGATCATCGG - Intergenic
1045995887 8:108360958-108360980 CCAGTTGAAAACCTCATAAAGGG + Intronic
1047603597 8:126452079-126452101 ACAGTTGAAAACATGTTTATGGG - Intergenic
1050399582 9:5237461-5237483 CCATGTCAAAACCAGAATATTGG - Intergenic
1051866475 9:21688710-21688732 CCAGATCAAATCCTGGATATTGG - Intergenic
1053779535 9:41590972-41590994 CCAGTTAATAACCTTATAATAGG + Intergenic
1054167491 9:61801213-61801235 CCAGTTAATAACCTTATAATAGG + Intergenic
1054670051 9:67779687-67779709 CCAGTTAATAACCTTATAATAGG - Intergenic
1058142264 9:101369609-101369631 CCAGTTAAAAATCTGCTTATTGG - Intronic
1188717556 X:33478569-33478591 CCAGCTAAAAACATGATCATGGG + Intergenic
1189026218 X:37397694-37397716 CCAGTTCAAAACATATTTAAGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1192129251 X:68532557-68532579 CCTGATCAAAATCTGAATATTGG - Exonic
1192884550 X:75323208-75323230 CCAGTTCATAGCCAGATTTTGGG - Intergenic
1198798818 X:140428879-140428901 CCATTTTAAAATCAGATTATTGG - Intergenic