ID: 1019998226

View in Genome Browser
Species Human (GRCh38)
Location 7:4738878-4738900
Sequence CTCCCATAGGTCTGCTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019998226_1019998231 20 Left 1019998226 7:4738878-4738900 CCTGGCTAGCAGACCTATGGGAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1019998231 7:4738921-4738943 TGAGTCACTTCCTTTGAAGCGGG No data
1019998226_1019998232 27 Left 1019998226 7:4738878-4738900 CCTGGCTAGCAGACCTATGGGAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1019998232 7:4738928-4738950 CTTCCTTTGAAGCGGGTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 83
1019998226_1019998233 28 Left 1019998226 7:4738878-4738900 CCTGGCTAGCAGACCTATGGGAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1019998233 7:4738929-4738951 TTCCTTTGAAGCGGGTCCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 99
1019998226_1019998230 19 Left 1019998226 7:4738878-4738900 CCTGGCTAGCAGACCTATGGGAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1019998230 7:4738920-4738942 CTGAGTCACTTCCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 51
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019998226 Original CRISPR CTCCCATAGGTCTGCTAGCC AGG (reversed) Intronic