ID: 1019998229

View in Genome Browser
Species Human (GRCh38)
Location 7:4738904-4738926
Sequence GACTCAGCATTACAAATGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019998229_1019998232 1 Left 1019998229 7:4738904-4738926 CCGCACATTTGTAATGCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1019998232 7:4738928-4738950 CTTCCTTTGAAGCGGGTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 83
1019998229_1019998233 2 Left 1019998229 7:4738904-4738926 CCGCACATTTGTAATGCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1019998233 7:4738929-4738951 TTCCTTTGAAGCGGGTCCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 99
1019998229_1019998236 18 Left 1019998229 7:4738904-4738926 CCGCACATTTGTAATGCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1019998236 7:4738945-4738967 CCCTGGGAAGAAGACGCAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 277
1019998229_1019998230 -7 Left 1019998229 7:4738904-4738926 CCGCACATTTGTAATGCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1019998230 7:4738920-4738942 CTGAGTCACTTCCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 51
4: 256
1019998229_1019998231 -6 Left 1019998229 7:4738904-4738926 CCGCACATTTGTAATGCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1019998231 7:4738921-4738943 TGAGTCACTTCCTTTGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019998229 Original CRISPR GACTCAGCATTACAAATGTG CGG (reversed) Intronic