ID: 1019998233

View in Genome Browser
Species Human (GRCh38)
Location 7:4738929-4738951
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019998229_1019998233 2 Left 1019998229 7:4738904-4738926 CCGCACATTTGTAATGCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1019998233 7:4738929-4738951 TTCCTTTGAAGCGGGTCCCTGGG No data
1019998226_1019998233 28 Left 1019998226 7:4738878-4738900 CCTGGCTAGCAGACCTATGGGAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1019998233 7:4738929-4738951 TTCCTTTGAAGCGGGTCCCTGGG No data
1019998228_1019998233 15 Left 1019998228 7:4738891-4738913 CCTATGGGAGGAGCCGCACATTT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1019998233 7:4738929-4738951 TTCCTTTGAAGCGGGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr