ID: 1019999070

View in Genome Browser
Species Human (GRCh38)
Location 7:4744673-4744695
Sequence CGGGGACTCGCAGTCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019999070_1019999080 3 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG No data
Right 1019999080 7:4744699-4744721 GGGGGTGCGAGCAGCTCCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 178
1019999070_1019999084 30 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG No data
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363
1019999070_1019999079 2 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG No data
Right 1019999079 7:4744698-4744720 AGGGGGTGCGAGCAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019999070 Original CRISPR CGGGGACTCGCAGTCACAGG AGG (reversed) Intronic