ID: 1019999070

View in Genome Browser
Species Human (GRCh38)
Location 7:4744673-4744695
Sequence CGGGGACTCGCAGTCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019999070_1019999080 3 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG 0: 1
1: 0
2: 0
3: 14
4: 84
Right 1019999080 7:4744699-4744721 GGGGGTGCGAGCAGCTCCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 178
1019999070_1019999079 2 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG 0: 1
1: 0
2: 0
3: 14
4: 84
Right 1019999079 7:4744698-4744720 AGGGGGTGCGAGCAGCTCCCTGG No data
1019999070_1019999084 30 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG 0: 1
1: 0
2: 0
3: 14
4: 84
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019999070 Original CRISPR CGGGGACTCGCAGTCACAGG AGG (reversed) Intronic
900247618 1:1645044-1645066 TGGGCACTTGCTGTCACAGGCGG - Intronic
900258844 1:1712182-1712204 TGGGCACTTGCTGTCACAGGCGG - Intronic
904622107 1:31781868-31781890 CGGGCACACGCTGTCACACGCGG + Intergenic
905291241 1:36923057-36923079 CGAGGGCTCTGAGTCACAGGAGG + Intronic
916053116 1:161049594-161049616 GGAGGACTCGCTGTCCCAGGAGG - Exonic
922237013 1:223729630-223729652 AGGGGGCTCCGAGTCACAGGTGG + Intronic
1062961440 10:1576100-1576122 AGGGGGCTCAGAGTCACAGGAGG + Intronic
1062961516 10:1576378-1576400 AGGGGGCTCAGAGTCACAGGAGG + Intronic
1072950849 10:99845537-99845559 TGGGCATTCACAGTCACAGGAGG - Intronic
1076827118 10:132974644-132974666 CGGGGAGAGGCAGGCACAGGCGG - Intergenic
1077103091 11:830761-830783 CGGGGACGCTAAGGCACAGGGGG - Intronic
1078507696 11:11964926-11964948 CGGGGCCTGAGAGTCACAGGAGG - Intronic
1082974803 11:59060846-59060868 CAGGGAATCGAAGACACAGGGGG + Intergenic
1088891697 11:114049721-114049743 CGGGAACTTGGAGTCACAGAGGG - Intergenic
1104441214 12:128794810-128794832 GGGGGATTAGCAGTCACAGGAGG - Intronic
1105529131 13:21202600-21202622 CAGGGACTTGCAGTCATGGGTGG + Intergenic
1111379363 13:87426616-87426638 CGGGGCCTCGTGGGCACAGGAGG - Intergenic
1113485113 13:110647374-110647396 TAGGGACTCGCGGTCACTGGAGG - Intronic
1121314765 14:92954320-92954342 GGGTGACTGGCAGCCACAGGAGG - Intronic
1122124788 14:99573146-99573168 CGGGGACTCCGAGGCACCGGGGG - Intronic
1122141909 14:99667810-99667832 AGGGGACCCGCAGGCACATGTGG - Intronic
1122321684 14:100859313-100859335 CGGGGACAGGCAGTCACTGGTGG + Intergenic
1123004252 14:105314096-105314118 CGGGGACTCGAAGCCACTCGGGG - Exonic
1124220741 15:27847857-27847879 TGGGGACAGGCAGTCCCAGGTGG + Intronic
1126413544 15:48395798-48395820 CGCTGCCTCCCAGTCACAGGTGG - Intergenic
1128186982 15:65650906-65650928 CGGGGACTGTCAGCCACAGTGGG - Exonic
1129313301 15:74726569-74726591 CGGGGGCTCGCAGTCACGCGAGG + Intergenic
1131531881 15:93200734-93200756 CGGGAACTCGCAGTCACCTCTGG - Intergenic
1133009909 16:2905184-2905206 CGAGGACGCGCAGCCAGAGGGGG + Intergenic
1139127615 16:64098706-64098728 TGGGGACTTGCAGCCCCAGGAGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1143078601 17:4365847-4365869 CGGGGACTCGCAGCCGCACTGGG + Intronic
1146724316 17:35145338-35145360 CAGGGTCTCGCTGTCACAAGTGG - Intergenic
1147582436 17:41634930-41634952 TGGAGACTCCCAGTCAGAGGAGG + Intergenic
1155176757 18:23307815-23307837 TGGGGACTCAGAGTCCCAGGAGG - Intronic
1160914096 19:1488490-1488512 CGGGGACCTGCAGTCACCCGCGG - Intronic
1163103251 19:15109807-15109829 GGGGGCCTCGCAGGCTCAGGCGG - Exonic
926581574 2:14635565-14635587 GGGAGACTCGCAGGCAAAGGCGG - Exonic
928499830 2:31879047-31879069 CAGGGAAACACAGTCACAGGAGG - Intronic
929146254 2:38709203-38709225 AGGGGCCTGGCAGTCCCAGGAGG + Intronic
931269012 2:60685599-60685621 CCTCCACTCGCAGTCACAGGTGG + Intergenic
934615125 2:95765786-95765808 CTGGGCCTCAGAGTCACAGGAGG - Intergenic
934645778 2:96058701-96058723 CTGGGCCTCAGAGTCACAGGAGG + Intergenic
934839182 2:97614790-97614812 CTGGGCCTCAGAGTCACAGGAGG + Intergenic
935215851 2:100974939-100974961 CATGGACTCGCACTCACAGGTGG - Exonic
944466875 2:200010792-200010814 CTGGGAATCACAGTCTCAGGTGG + Intergenic
946044576 2:216810529-216810551 AGGGGACTCTCAGCCACGGGAGG + Intergenic
948863454 2:240763883-240763905 CGGCCACTAGCAGGCACAGGTGG + Intronic
1172961855 20:38805733-38805755 CGGGGACCCACAGACACAGCCGG + Exonic
1175494607 20:59404882-59404904 GGGGGCCTCTCAGTCACAGCTGG + Intergenic
1179108162 21:38422094-38422116 AGGAGACTGGCAGTCACAGGTGG + Intronic
1179994899 21:44969500-44969522 CGGGGACTCCCAGCGACAGGAGG - Intronic
1183452953 22:37906563-37906585 CGGGGCCCCGCACTCACAGCAGG - Exonic
1183531028 22:38353432-38353454 CTCGGAGTCGCAGTCTCAGGTGG - Intronic
1184516527 22:44965852-44965874 CAGGGACTCCTAGGCACAGGGGG + Intronic
950711178 3:14813974-14813996 GGGGGAATCGCACTGACAGGAGG - Intergenic
985626443 5:991440-991462 CTGAGCCTCCCAGTCACAGGGGG + Intergenic
989226336 5:39033670-39033692 CGGGGACTAGTAGTCAGGGGAGG + Intronic
997758207 5:136420288-136420310 CGGGATCTAGCAGTCACAGGTGG + Intergenic
1002638398 5:180619215-180619237 CGGGGTCTCGCCGTCCCAGCGGG + Intronic
1003402837 6:5804770-5804792 CAGGGACTTGCAGTCATGGGTGG - Intergenic
1006155752 6:32011974-32011996 CAGGGACTTGCAGCCACAGGGGG + Intergenic
1006162083 6:32044828-32044850 CAGGGACTTGCAGCCACAGGGGG + Intronic
1007423408 6:41733264-41733286 TGGTGACTCACAGTCAGAGGTGG - Intronic
1015517176 6:134094613-134094635 CTGGGAGTTGCAGTCACAGCAGG + Intergenic
1019999070 7:4744673-4744695 CGGGGACTCGCAGTCACAGGAGG - Intronic
1021927669 7:25548934-25548956 CTGGGACTTGTAGTTACAGGAGG + Intergenic
1025012276 7:55407041-55407063 GGGGGACTCTCTGGCACAGGAGG + Intronic
1032125447 7:129189430-129189452 CGGAGACTCGGACTCCCAGGAGG + Exonic
1032764278 7:134975923-134975945 CTGGGACCCTCAGTTACAGGGGG + Intergenic
1035355385 7:158273463-158273485 GGGGGAGCCGCAGGCACAGGGGG + Intronic
1035355391 7:158273481-158273503 GGGGGAGCCGCAGGCACAGGGGG + Intronic
1035355404 7:158273537-158273559 CGGGGAGCCGCAGACACAGGGGG + Intronic
1035355410 7:158273555-158273577 GGGGGAGCCGCAGGCACAGGGGG + Intronic
1035355440 7:158273684-158273706 CAGGGAGCCGCAGACACAGGGGG + Intronic
1035355461 7:158273788-158273810 CGGGGAGCCGCAGACACAGGGGG + Intronic
1035355472 7:158273823-158273845 GGGGGAGCCGCAGACACAGGGGG + Intronic
1035355475 7:158273841-158273863 GGGGGAGCCGCAGACACAGGAGG + Intronic
1035355493 7:158273929-158273951 GGGGGAGCCGCAGACACAGGGGG + Intronic
1035355507 7:158274001-158274023 CAGGGAGCCGCAGACACAGGGGG + Intronic
1035355510 7:158274019-158274041 GGGGGAGCCGCAGACACAGGAGG + Intronic
1035355517 7:158274049-158274071 CGAGGAGCCGCAGGCACAGGGGG + Intronic
1035355522 7:158274067-158274089 GGGGGAGCCGCAGACACAGGGGG + Intronic
1035355537 7:158274139-158274161 CAGGGAGCCGCAGACACAGGGGG + Intronic
1035355540 7:158274157-158274179 GGGGGAGCCGCAGACACAGGAGG + Intronic
1035355546 7:158274187-158274209 CGAGGAGCCGCAGACACAGGGGG + Intronic
1035355562 7:158274258-158274280 CGGGGAGCCGCAGACACAGGGGG + Intronic
1035355565 7:158274276-158274298 GGGGGAGACGCAGACACAGGAGG + Intronic
1035355584 7:158274359-158274381 GGGGGAGCCGCAGACACAGGGGG + Intronic
1035355590 7:158274377-158274399 GGGGGAGCCGCAGGCACAGGGGG + Intronic
1035355607 7:158274451-158274473 CGGGGAGCCGCAGACACAGGAGG + Intronic
1035355614 7:158274481-158274503 CGAGGAGCCGCAGGCACAGGGGG + Intronic
1035355626 7:158274516-158274538 GGGGGAGCCGCAGGCACAGGGGG + Intronic
1043502904 8:80874134-80874156 CGGGGACTCGCGGCCGCAAGGGG + Intronic
1049297090 8:141847125-141847147 AGGGGACATGCACTCACAGGAGG + Intergenic
1053042242 9:34884742-34884764 CAGGGACTCCCAGTCCCTGGAGG + Intergenic
1056189991 9:84175688-84175710 CTGGGACTCGCAGCCCCAGGTGG + Intergenic
1058527081 9:105869827-105869849 CGGCAACTCACAATCACAGGTGG - Intergenic
1186807136 X:13151544-13151566 CGGGGACTCTAACTCAAAGGTGG + Intergenic