ID: 1019999079

View in Genome Browser
Species Human (GRCh38)
Location 7:4744698-4744720
Sequence AGGGGGTGCGAGCAGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019999071_1019999079 -1 Left 1019999071 7:4744676-4744698 CCTGTGACTGCGAGTCCCCGTCA No data
Right 1019999079 7:4744698-4744720 AGGGGGTGCGAGCAGCTCCCTGG No data
1019999070_1019999079 2 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG No data
Right 1019999079 7:4744698-4744720 AGGGGGTGCGAGCAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019999079 Original CRISPR AGGGGGTGCGAGCAGCTCCC TGG Intronic