ID: 1019999079 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:4744698-4744720 |
Sequence | AGGGGGTGCGAGCAGCTCCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1019999071_1019999079 | -1 | Left | 1019999071 | 7:4744676-4744698 | CCTGTGACTGCGAGTCCCCGTCA | No data | ||
Right | 1019999079 | 7:4744698-4744720 | AGGGGGTGCGAGCAGCTCCCTGG | No data | ||||
1019999070_1019999079 | 2 | Left | 1019999070 | 7:4744673-4744695 | CCTCCTGTGACTGCGAGTCCCCG | No data | ||
Right | 1019999079 | 7:4744698-4744720 | AGGGGGTGCGAGCAGCTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1019999079 | Original CRISPR | AGGGGGTGCGAGCAGCTCCC TGG | Intronic | ||