ID: 1019999080

View in Genome Browser
Species Human (GRCh38)
Location 7:4744699-4744721
Sequence GGGGGTGCGAGCAGCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019999070_1019999080 3 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG No data
Right 1019999080 7:4744699-4744721 GGGGGTGCGAGCAGCTCCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 178
1019999071_1019999080 0 Left 1019999071 7:4744676-4744698 CCTGTGACTGCGAGTCCCCGTCA No data
Right 1019999080 7:4744699-4744721 GGGGGTGCGAGCAGCTCCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019999080 Original CRISPR GGGGGTGCGAGCAGCTCCCT GGG Intronic