ID: 1019999084

View in Genome Browser
Species Human (GRCh38)
Location 7:4744726-4744748
Sequence CACCTGCCCTGCTCTTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 363}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019999076_1019999084 12 Left 1019999076 7:4744691-4744713 CCCCGTCAGGGGGTGCGAGCAGC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363
1019999071_1019999084 27 Left 1019999071 7:4744676-4744698 CCTGTGACTGCGAGTCCCCGTCA No data
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363
1019999078_1019999084 10 Left 1019999078 7:4744693-4744715 CCGTCAGGGGGTGCGAGCAGCTC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363
1019999070_1019999084 30 Left 1019999070 7:4744673-4744695 CCTCCTGTGACTGCGAGTCCCCG No data
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363
1019999077_1019999084 11 Left 1019999077 7:4744692-4744714 CCCGTCAGGGGGTGCGAGCAGCT No data
Right 1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG 0: 1
1: 0
2: 5
3: 40
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019999084 Original CRISPR CACCTGCCCTGCTCTTGCTG CGG Intronic