ID: 1020001173

View in Genome Browser
Species Human (GRCh38)
Location 7:4756825-4756847
Sequence CGGGAGCAGCACCGAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020001173_1020001180 5 Left 1020001173 7:4756825-4756847 CCTGTGCCTCGGTGCTGCTCCCG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1020001180 7:4756853-4756875 CCCAGCCAGCACAGCACCAAGGG 0: 1
1: 0
2: 1
3: 20
4: 241
1020001173_1020001186 23 Left 1020001173 7:4756825-4756847 CCTGTGCCTCGGTGCTGCTCCCG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1020001186 7:4756871-4756893 AAGGGCTCTGCACAGAGGGACGG 0: 1
1: 0
2: 3
3: 35
4: 383
1020001173_1020001178 4 Left 1020001173 7:4756825-4756847 CCTGTGCCTCGGTGCTGCTCCCG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1020001178 7:4756852-4756874 GCCCAGCCAGCACAGCACCAAGG 0: 1
1: 0
2: 3
3: 28
4: 305
1020001173_1020001183 18 Left 1020001173 7:4756825-4756847 CCTGTGCCTCGGTGCTGCTCCCG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1020001183 7:4756866-4756888 GCACCAAGGGCTCTGCACAGAGG 0: 1
1: 1
2: 3
3: 23
4: 235
1020001173_1020001184 19 Left 1020001173 7:4756825-4756847 CCTGTGCCTCGGTGCTGCTCCCG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1020001184 7:4756867-4756889 CACCAAGGGCTCTGCACAGAGGG 0: 1
1: 0
2: 5
3: 40
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020001173 Original CRISPR CGGGAGCAGCACCGAGGCAC AGG (reversed) Intronic
900214653 1:1475080-1475102 CTGGAGCAACTCAGAGGCACAGG - Intronic
900221862 1:1513429-1513451 CTGGAGCAACTCAGAGGCACAGG - Intronic
900472312 1:2860990-2861012 GGGAAGCAGCACAGAGGCAAAGG - Intergenic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
902042798 1:13504956-13504978 TGGGAGCAGAACTGGGGCACAGG - Intronic
902338551 1:15767775-15767797 CAGGTGCAGCAGCGAGGCAGTGG - Intronic
905279122 1:36837657-36837679 CGGGTGCTGAACCGAGGAACTGG - Intronic
905655477 1:39683860-39683882 CGAGAGCAGCGCGGAGGCAGGGG + Intronic
905755892 1:40508846-40508868 CGGGAGCAGCTCCGAGGCCGCGG + Exonic
907356575 1:53879911-53879933 CAGGAGCAGCACGGAGACAAAGG + Intronic
908452492 1:64269698-64269720 AGGGAGCAGCAGGGAGGCAAAGG - Intergenic
910113041 1:83702211-83702233 AGGGAGCAGCACCTAGGAGCTGG - Intergenic
912052897 1:105553068-105553090 CTAGAGCAGCAACTAGGCACAGG - Intergenic
917173347 1:172201989-172202011 CGGGAGCAACACGGAGCCAGGGG - Intronic
918423400 1:184386465-184386487 CGGGCGCAGCCCAGAGGCCCGGG - Intergenic
919802334 1:201361418-201361440 CGGGACCAGGACGGAGGCCCAGG - Intronic
1070071800 10:73096996-73097018 TGGGGGCAGCAGGGAGGCACGGG - Intergenic
1070797674 10:79226304-79226326 CGGGAGCACCACTGAGTCCCTGG - Intronic
1072163257 10:92787744-92787766 CTTCAGCAGCACGGAGGCACAGG - Intergenic
1075688659 10:124380639-124380661 CGGGAGGAGCACAGAGGAGCTGG - Intergenic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1077124003 11:924625-924647 CGGGTGCCGCACCCAGGCTCTGG - Intergenic
1077338916 11:2017455-2017477 CAGGAGCAGCAAACAGGCACTGG - Intergenic
1078429973 11:11281115-11281137 TGGGAGCAGCACGCAGGCAGGGG + Intronic
1079060467 11:17244383-17244405 TGGGAGCAGGACTGAGGCAAAGG + Intronic
1081587691 11:44398535-44398557 CGGGAGCAGCAGGGGGGAACTGG + Intergenic
1081863619 11:46347837-46347859 CGGGGCAGGCACCGAGGCACCGG + Intronic
1082714705 11:56597918-56597940 AGGGAGCAGCAGCGAGACAGAGG + Intergenic
1083340538 11:61955962-61955984 CGGGAGCAACGGGGAGGCACCGG + Intronic
1084019460 11:66409185-66409207 CGGGGGCAGCTCCCAGGCTCTGG - Intergenic
1084267773 11:68013785-68013807 CGGGAGCAGGACTGAGACCCAGG - Intronic
1090265537 11:125350941-125350963 TGGTAGCAGCACCGGGGGACTGG - Intronic
1090662198 11:128890601-128890623 CGGGAGCAGCCCGGAGGGAACGG - Intergenic
1202821900 11_KI270721v1_random:72637-72659 CAGGAGCAGCAAACAGGCACTGG - Intergenic
1094425216 12:30310113-30310135 CAGGAGCAGCACAGAGGCAAAGG + Intergenic
1096078481 12:48818869-48818891 CGGGAGCGGCCCGGAGGCAGGGG - Exonic
1096386809 12:51199691-51199713 CGGGGGCAGGAGCGAGGCATGGG - Intronic
1097264734 12:57738480-57738502 CTGGAGCAGCACCAAGGTCCCGG - Intronic
1104827240 12:131721142-131721164 CGGGAGCAGCACCGAGGAGATGG + Intronic
1104914692 12:132258600-132258622 CGGCAGCTGCACCGAAGCCCGGG + Intronic
1105453235 13:20518743-20518765 CGGGACCAGGACGGAGGCAGAGG + Intronic
1108479667 13:50856046-50856068 CAGGAGCAGCACAGAGCCAAAGG + Intergenic
1115399379 14:32939706-32939728 CGGGAGCAGCAGCGAGGGTGGGG + Intronic
1115506347 14:34097739-34097761 AGGGAGCTGGACTGAGGCACCGG - Intronic
1121624984 14:95377309-95377331 CGGGAACAACACCGAGGGAATGG + Intergenic
1123456447 15:20430644-20430666 TGAGGGCAGCAGCGAGGCACAGG - Intergenic
1123661616 15:22569714-22569736 TGAGGGCAGCAGCGAGGCACAGG + Intergenic
1124160163 15:27260857-27260879 CGGGAGCAGGAGTGAGGCTCTGG + Intronic
1124262586 15:28205795-28205817 TGAGGGCAGCAGCGAGGCACAGG - Intronic
1124265550 15:28230699-28230721 GGGGAGAAGCCCCGAAGCACGGG + Intronic
1124315415 15:28663947-28663969 TGAGGGCAGCAGCGAGGCACAGG + Intergenic
1124923224 15:34046822-34046844 TGGGAGCAGCACAGAGCCAAAGG + Exonic
1125054609 15:35342421-35342443 CGGGAGCAGCATGGAGCCAAAGG - Intronic
1125216737 15:37283602-37283624 CAGGAGCAGCACAGAGCCAAGGG - Intergenic
1128054790 15:64691514-64691536 CAGGAGCACCACAGAGGCCCTGG + Exonic
1128181707 15:65610931-65610953 CGGGAGCAGCGCCCCGGAACTGG + Intronic
1128300907 15:66565780-66565802 CGTGTGCAGGACAGAGGCACTGG - Intronic
1129104560 15:73297141-73297163 CAGAAGCAGCACCAAGGCCCGGG - Intronic
1129331915 15:74832222-74832244 CAGGAGCAGCTCAGAGGCCCAGG - Intergenic
1132985268 16:2763065-2763087 CTGGAACACCACCGAGGCAAGGG + Exonic
1133115753 16:3577151-3577173 CTGGAGCAGCATCGAGGCCCGGG - Exonic
1137728853 16:50675220-50675242 GAGGAGCAGCTCCCAGGCACAGG + Intronic
1138066121 16:53942980-53943002 AGGGAGAAGCAGGGAGGCACTGG + Intronic
1139652704 16:68370646-68370668 AGGGATGAGCACCGAGGCTCTGG - Intronic
1141798697 16:86292379-86292401 CAGGAGCTGCCCCGGGGCACGGG - Intergenic
1141967607 16:87457132-87457154 CTGGAGCTGCAGCCAGGCACTGG + Intronic
1142623601 17:1179550-1179572 CGGGATCGGGACCCAGGCACCGG - Intronic
1142639994 17:1280218-1280240 CGGGAGGGGGACCGAGGCAGTGG - Exonic
1143679272 17:8464341-8464363 AGGGAGCAGCAAAGAGCCACAGG - Intronic
1144725517 17:17499996-17500018 CAGGAGCAGGACGGAGGCACTGG + Intergenic
1144756866 17:17685226-17685248 CGGGAGAGGCACCTGGGCACTGG + Intronic
1145847024 17:28048959-28048981 CTGGAGTAGCACAGAGGCACAGG - Intronic
1146492445 17:33292456-33292478 CGGGCGCAGCACCCAGGGACTGG - Exonic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1148856001 17:50579650-50579672 CTGGGGTAGCACGGAGGCACTGG + Intronic
1150124593 17:62627959-62627981 CGGGGGGAGCGCCGAGGCGCGGG + Intronic
1152624456 17:81381895-81381917 CGGGAGCGGCGCCAAAGCACGGG - Intergenic
1152688282 17:81705619-81705641 AGGGAGCAGCAGCGAGGTACAGG + Intronic
1152760996 17:82107003-82107025 AGGGAGCAGCCCTGAGACACGGG - Intronic
1153003871 18:480487-480509 CAGGAGCTGCACCCAGGCATGGG - Intronic
1153460193 18:5324878-5324900 TGGGAGCAGCACAGAGCCAGAGG + Intergenic
1154502005 18:15001772-15001794 CTGGAGCAGCACCCAGGTAAGGG - Intergenic
1156484455 18:37456097-37456119 CTGAAGCAGGACCGAGGCTCTGG - Intronic
1157185962 18:45540262-45540284 CAGGAGCAGACCCGAGGAACAGG - Intronic
1157594425 18:48855518-48855540 CGAGAGCATCACCTAGTCACAGG - Intronic
1157724281 18:49951855-49951877 AGGGAGGAGCCCCAAGGCACAGG - Intronic
1160041511 18:75349819-75349841 CAGGAGCAGCAGCGAGCCTCCGG + Intergenic
1160080233 18:75719692-75719714 TGAGAGCAGCACCAAGGCAAAGG + Intergenic
1161072968 19:2271422-2271444 CAGGAGCACCACCGAGGCCCCGG - Exonic
1161086560 19:2338240-2338262 CGGGGGCAGCCCAGAGCCACAGG - Intronic
1162144435 19:8605241-8605263 CGGAGGCAGCGCCGCGGCACGGG - Exonic
1165102480 19:33447093-33447115 CAGAAGCAGCACGGTGGCACAGG - Intronic
1165129428 19:33622611-33622633 CGCGGGCAGCACCGAGGGCCAGG - Intronic
1166978932 19:46621492-46621514 CGTGGGCAGGCCCGAGGCACAGG + Exonic
1167667237 19:50829941-50829963 CTGGGGCAGCACCCAGACACGGG + Intronic
925417020 2:3677570-3677592 GAGGAGGAGCACTGAGGCACAGG + Intronic
926116763 2:10218280-10218302 CGGGAGGACCACCTGGGCACAGG - Intergenic
929595163 2:43170994-43171016 CGGGATGAGCACCGAGGAGCTGG - Intergenic
934548577 2:95240338-95240360 CAGGAGCAGCACAGAGCCAAAGG + Intronic
938188323 2:129253001-129253023 AGGGAGCAGCACCAAGCCACAGG - Intergenic
938501183 2:131831942-131831964 CTGGAGCAGCACCCAGGTAAGGG - Intergenic
939180253 2:138795291-138795313 CAGGAGCAGCACTGAGCCAAAGG - Intergenic
941109442 2:161402546-161402568 TGGGAGGATCACCGAGGCCCAGG + Intronic
944112207 2:196144790-196144812 TGGGAGCAGCACCTTGGCAGAGG - Intronic
948537139 2:238654719-238654741 TGGGAACAGCAGGGAGGCACAGG - Intergenic
1172126690 20:32628746-32628768 CGGGAGCAGCAAGGGGCCACGGG + Intergenic
1174393988 20:50234680-50234702 CTGGGGAAGCACCGAGGCTCTGG + Intergenic
1174581845 20:51577902-51577924 CGGGACCAGCAGCGAGGAATGGG - Intergenic
1175995724 20:62811537-62811559 CGGCTGGAGGACCGAGGCACGGG + Exonic
1176042375 20:63072334-63072356 CGGGGGCAGCAGCGGGGCGCGGG + Intergenic
1176296552 21:5076325-5076347 CGGGACCAGCACAGAGGCTGTGG - Intergenic
1178431292 21:32520688-32520710 GGGGAGCAGCGCCGAGACCCAGG - Intergenic
1179860497 21:44185796-44185818 CGGGACCAGCACAGAGGCTGTGG + Intergenic
1181285736 22:21751027-21751049 TGGGAGCAACACCTAGGCCCAGG - Intergenic
1181950343 22:26549367-26549389 CAGGGGCAGCAGCCAGGCACAGG + Intronic
1183228570 22:36566565-36566587 GGAGAGCAGCCCCGAGGCGCTGG + Intronic
1184856754 22:47150541-47150563 CGGCAGAAGTACCGTGGCACAGG - Intronic
1185232381 22:49690574-49690596 TGGGAGCACCACCCAGCCACAGG + Intergenic
1185232395 22:49690648-49690670 CGGGAGCACCACTCAGCCACAGG + Intergenic
950587309 3:13903887-13903909 TGGGAGCAGCACCAAGCCAAGGG + Intergenic
954468882 3:50675003-50675025 CGGGAGCAGCGGCGACGGACAGG + Intergenic
954540624 3:51391241-51391263 CGGGAGCGGCGCCGAGGGGCCGG - Intergenic
960960487 3:123067299-123067321 GGGGAGCTGCCCCGGGGCACCGG + Intronic
961215964 3:125160831-125160853 AGGGAGCTGCACGGGGGCACAGG + Intronic
961942267 3:130650296-130650318 AGGGAGCAGCAAAGAGGCATTGG + Intronic
962848115 3:139288573-139288595 CGGCAGCAGCACCGAGGGTAAGG - Intronic
964524860 3:157607535-157607557 TGGGGGCGGCACCTAGGCACTGG - Intronic
967919834 3:194606229-194606251 CGGGAGCAGCACTGTGGTTCAGG - Intronic
968456791 4:704426-704448 CGGGAGCAGCCACCAGGCAGGGG - Intergenic
968620468 4:1601487-1601509 CGGGAGGGGCAGCAAGGCACAGG - Intergenic
968651997 4:1763835-1763857 GGGGTGCAGCACCGAGCCCCCGG - Intergenic
969508858 4:7605765-7605787 CAGGACCAGCACCAAGCCACAGG - Intronic
969960962 4:10944460-10944482 CAGGAGCAGCAAGCAGGCACAGG - Intergenic
970450963 4:16166143-16166165 CAGGAGCAGCTCCCAGGCAGAGG - Intronic
975208582 4:71672509-71672531 CGGGAGAAGCATGGAGGCCCAGG + Intergenic
977668687 4:99670871-99670893 CAGGAGCAGCACAGAGCCAAAGG + Intergenic
978371235 4:108031353-108031375 TGAGGGCAGCACCTAGGCACAGG + Intronic
981550519 4:145937493-145937515 CGGGAGCTGCGCCGAGGCGAAGG - Intronic
984886242 4:184452201-184452223 CGACAGCAGCACAGGGGCACAGG + Intronic
986295601 5:6435494-6435516 TGGGAGAAGCACCCAGGCTCAGG - Intergenic
986394345 5:7313924-7313946 CGGGAAGAGCACCGTGGCAAAGG + Intergenic
987270758 5:16306039-16306061 CTGGACCAGCACAGAGGCCCTGG + Intergenic
992069850 5:73138275-73138297 CGGGAGCAGCACGGAAGAGCCGG + Intergenic
992596509 5:78352955-78352977 CGGGAACTGCACCCAGGCAGAGG + Intergenic
1001055295 5:168444553-168444575 CAGGAGCAGCACACAGACACTGG + Exonic
1002465766 5:179407696-179407718 CAGGACCAGGGCCGAGGCACAGG - Intergenic
1007133781 6:39501110-39501132 CGGGAGCAACACAGAGCCAAGGG + Intronic
1007178114 6:39910047-39910069 CGGGAGGAGCACCAGGGCCCAGG + Intronic
1007278243 6:40691324-40691346 CGGGAGCAGCACCGTGGTGATGG - Intergenic
1007473365 6:42104685-42104707 GGGGAGCCGCACCGAGGCCCAGG - Exonic
1008358519 6:50586222-50586244 GGCGAGCCGCCCCGAGGCACAGG - Intergenic
1013108515 6:107046652-107046674 CGGGGTCAGCAGCCAGGCACAGG - Intronic
1019082108 6:169441441-169441463 GGTGGGAAGCACCGAGGCACAGG + Intergenic
1019195707 6:170281531-170281553 CAGGAGCTGCGCGGAGGCACTGG - Intergenic
1020001173 7:4756825-4756847 CGGGAGCAGCACCGAGGCACAGG - Intronic
1023067327 7:36390426-36390448 CGGCAGCCGCACTGAGTCACCGG - Intronic
1023583916 7:41709126-41709148 TGGGAGCAGCTCCAAGGCATGGG + Intergenic
1030234305 7:107242280-107242302 CGGGAGCAACACAGAGCCAGGGG + Intronic
1033564967 7:142569625-142569647 CAGGAGCAGCACAGAGCCAAAGG + Intergenic
1034364569 7:150534966-150534988 CAGGAGCAACACAGAGGCAGGGG - Intergenic
1035388518 7:158490079-158490101 CGGGAGCAGCAGCGGGGCCGGGG + Intronic
1035648426 8:1246482-1246504 GGGGAGCAGCACAGAGCCATTGG + Intergenic
1037918110 8:22785091-22785113 CGGGAGCAGCATCTAGGCCTGGG - Intronic
1040481930 8:47834346-47834368 CGGGAGCAGCACTGACCCGCTGG - Exonic
1040981849 8:53252251-53252273 CTGGAGCACCACTGAGGCCCGGG - Intergenic
1042484376 8:69334496-69334518 CTGGAGCAGCCCCGACTCACAGG + Intergenic
1042737509 8:72005300-72005322 GGCGAGCAGCACCGAAGCGCGGG + Intronic
1045338821 8:101233549-101233571 AGGGACAAGCACCGAGGCTCTGG + Intergenic
1047773522 8:128049715-128049737 AGGGAGCAGCAGGGAGGCAGTGG - Intergenic
1048328077 8:133453750-133453772 CAGGAGCAGGACAGAGGCATGGG + Intergenic
1049355679 8:142186987-142187009 CGAGGGCTGCACGGAGGCACAGG + Intergenic
1049581529 8:143413387-143413409 CGGCAGCAGCACCCAGAGACTGG + Intergenic
1049593827 8:143474442-143474464 TGGGAGCAGCACGGGGGCCCTGG - Intronic
1049596487 8:143486342-143486364 CTGGGGCCGCACCGAGGCTCTGG + Intronic
1049813821 8:144588708-144588730 CGGAGGCAGCACGGCGGCACGGG + Intronic
1050240300 9:3627141-3627163 TGGGAGCAGCACAGAGGCAAAGG - Intergenic
1053221523 9:36317022-36317044 CGGCCCCAGCACCCAGGCACAGG + Intergenic
1054196805 9:62040117-62040139 CGGGAGCAGGCCGGCGGCACAGG + Intergenic
1054641600 9:67548577-67548599 CGGGAGCAGGCCGGCGGCACAGG - Intergenic
1058710478 9:107674848-107674870 CGGGAGCAGCAGGGAGGCCCTGG - Intergenic
1059453600 9:114386377-114386399 CGGGAACAGCACGGAGGCAAAGG + Intronic
1061573365 9:131491434-131491456 CCGGAGCCGTACCGAGGCAGTGG - Exonic
1062186288 9:135220385-135220407 AGGGGGCAGTACCGAGACACAGG + Intergenic
1062402609 9:136379073-136379095 CGGGAGCACCACCGGGCCCCGGG + Exonic
1186340887 X:8645200-8645222 AGGGAGAAGCACTGAGGCAGAGG + Intronic
1186964531 X:14772925-14772947 CGGGAGCAGCATGGAGCCAAAGG - Intergenic
1189744671 X:44157689-44157711 CGGGAGAAGCAGGGAGGGACTGG - Intronic
1194580448 X:95665355-95665377 CGGGAGCAGCAGGGAGCCAGTGG + Intergenic
1198686986 X:139237652-139237674 GGGGAGCAGCACAGAGCCAAGGG + Intergenic
1199288504 X:146080425-146080447 AGGGAGCAGAATTGAGGCACTGG - Intergenic