ID: 1020001250

View in Genome Browser
Species Human (GRCh38)
Location 7:4757206-4757228
Sequence CTTTCCTAACAGCTGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 4, 3: 13, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020001250_1020001257 25 Left 1020001250 7:4757206-4757228 CCGTCCTCCAGCTGTTAGGAAAG 0: 1
1: 1
2: 4
3: 13
4: 237
Right 1020001257 7:4757254-4757276 ACGTGGCGCAGTCAGCCCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 81
1020001250_1020001255 8 Left 1020001250 7:4757206-4757228 CCGTCCTCCAGCTGTTAGGAAAG 0: 1
1: 1
2: 4
3: 13
4: 237
Right 1020001255 7:4757237-4757259 CCCTGGAGTTTAGAGATACGTGG 0: 1
1: 0
2: 0
3: 9
4: 181
1020001250_1020001253 -9 Left 1020001250 7:4757206-4757228 CCGTCCTCCAGCTGTTAGGAAAG 0: 1
1: 1
2: 4
3: 13
4: 237
Right 1020001253 7:4757220-4757242 TTAGGAAAGCTGAGCTGCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020001250 Original CRISPR CTTTCCTAACAGCTGGAGGA CGG (reversed) Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
901188053 1:7387605-7387627 CTTTTCTTAAAGCTGGAGGCAGG + Intronic
901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG + Intergenic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
904036780 1:27563381-27563403 CCTTCCTCACACCTGGAAGATGG - Intronic
904329077 1:29746213-29746235 CTTTCCTTCCAGCTGCAGAAGGG - Intergenic
904592046 1:31620308-31620330 TTTTCCTAACAGCCTGGGGAAGG + Intronic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
904900969 1:33856715-33856737 GCTGCCCAACAGCTGGAGGATGG + Intronic
905889576 1:41510857-41510879 CTCTCCTCAGAGCTGGAGGGCGG - Exonic
906519533 1:46458941-46458963 CTTGCCAGACAACTGGAGGAAGG - Intergenic
906632998 1:47388045-47388067 CTTTCATAACAGGTAAAGGAAGG + Intergenic
907629721 1:56068303-56068325 CTTTCCTGACTGCTGGGGGGTGG - Intergenic
908248978 1:62250282-62250304 CTTTAATAACAGCTGGGGGCTGG - Intronic
908779632 1:67678024-67678046 CTTTCCTAAAATAGGGAGGACGG + Intergenic
911885903 1:103299284-103299306 CTATCCTTATAGCTGGGGGAGGG - Intergenic
911944128 1:104084396-104084418 CATTCCCAACACCTGGAGAAAGG - Intergenic
912960185 1:114189209-114189231 CTTTGCTGACAGGTGGAGGGAGG + Intergenic
913298266 1:117343502-117343524 CTTTCCTCACAGGTGGGAGATGG + Intergenic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
913596923 1:120387211-120387233 CTTTACTAACAACAAGAGGATGG + Intergenic
914090343 1:144491770-144491792 CTTTACTAACAACAAGAGGATGG - Intergenic
914308262 1:146442452-146442474 CTTTACTAACAACAAGAGGATGG + Intergenic
914593845 1:149130681-149130703 CTTTACTAACAACAAGAGGATGG - Intergenic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
915660752 1:157403293-157403315 CCTTCCTAACAGCCTGAGGGCGG + Intergenic
915918514 1:159956615-159956637 CTTTCCTCACTCCAGGAGGATGG - Intergenic
916184089 1:162113830-162113852 CCTTCCTAAGAGGTGAAGGATGG - Intronic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
916685344 1:167139769-167139791 AGTTCCTAACGACTGGAGGATGG - Intergenic
918050129 1:180966484-180966506 CTTTCCTCACAGGAGTAGGAGGG + Intergenic
918586167 1:186191341-186191363 CTTGCCTGACAGCTGGACTATGG - Intergenic
919786031 1:201259346-201259368 CCTTCCTGACAATTGGAGGAGGG + Intergenic
920228853 1:204457116-204457138 TTTTCGTCACAGCTGGAAGAAGG + Intronic
921948535 1:220905954-220905976 CTTTCCTTGAAACTGGAGGAGGG - Intergenic
923784516 1:237054338-237054360 TTTTCCTGACAGATGGAGGGAGG - Intronic
924259191 1:242212215-242212237 TTTTCCTATCTACTGGAGGAGGG - Intronic
1063009838 10:2011415-2011437 CTTTGATAACAGCTGGTGGTTGG + Intergenic
1064178632 10:13096866-13096888 CTTTCACAACAGTTGGAGGGAGG - Intronic
1064797333 10:19028147-19028169 CTTAGCTAAAAGCTGGTGGAAGG + Intergenic
1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG + Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067412979 10:46080803-46080825 CTGGCCTAACATCTGAAGGATGG - Intergenic
1067842474 10:49691896-49691918 CTTGCCTCACAGGTGGAGGTTGG + Intronic
1069590166 10:69636418-69636440 CTTCTCTAACAGCTGCGGGAGGG - Intergenic
1070214565 10:74363514-74363536 GTTCCCTAACAGCAGGAGGAGGG + Intronic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070425966 10:76287589-76287611 CTTTCCTAACAGGAGCAGGCTGG - Intronic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1071361827 10:84854562-84854584 GTTTTCTCACAGCTGTAGGATGG + Intergenic
1072331800 10:94361319-94361341 CTTACCTAACTGCTGGTGAATGG + Intronic
1074233864 10:111565111-111565133 GTTGCCTAATAGCTGGAGGTAGG + Intergenic
1075424678 10:122332424-122332446 TTTTCCTTTCAGCTGGAGAATGG + Exonic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077581068 11:3417707-3417729 CTTTCCTGACTGATGCAGGATGG - Intergenic
1077987899 11:7373742-7373764 GCTTCCAAACATCTGGAGGAGGG - Intronic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1078937844 11:15967581-15967603 ATTTGCTACAAGCTGGAGGAGGG + Exonic
1079339069 11:19597180-19597202 TCTTCCTAACAGCCTGAGGAAGG - Intronic
1084082617 11:66838613-66838635 CTGTCCTAACATCTTGGGGAGGG - Intronic
1087011352 11:93516963-93516985 CTTCCCTTAAAGCTGGATGATGG + Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1088500221 11:110475490-110475512 CTTTCCTAATAGCTAGCAGAGGG + Intergenic
1089189319 11:116642760-116642782 CATTCCTAGGGGCTGGAGGATGG + Intergenic
1091601583 12:1921210-1921232 CTTCCCTGACTGGTGGAGGAGGG + Intergenic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1092126944 12:6081086-6081108 CTTTCCTGAACGCAGGAGGATGG - Intronic
1092408669 12:8238175-8238197 CTTTCCTGACTGCTATAGGATGG - Intergenic
1093078854 12:14786784-14786806 ATTTCCAAAGAACTGGAGGAGGG + Exonic
1093299547 12:17438111-17438133 CTTTCCTATCAGCTTGATGGGGG - Intergenic
1093885386 12:24453683-24453705 CTTTCCTAGCTGCTGGATGTAGG - Intergenic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1096396348 12:51269702-51269724 CTCTCCTGACACCTGGTGGATGG - Intronic
1096755297 12:53794312-53794334 CTTTCCTAATAGATGGGGCAGGG + Intergenic
1098082030 12:66797339-66797361 CATCCCAAACAGCTGGAAGAAGG - Intronic
1099487794 12:83249610-83249632 CTATTCTGACATCTGGAGGATGG - Intergenic
1102576771 12:113860683-113860705 CTTTCCTGACCCCTGGAGGCTGG + Intronic
1103906573 12:124330765-124330787 CCTTCATGACAGCTGGAGCAGGG + Intronic
1105759821 13:23503493-23503515 GTTTCCTTGCACCTGGAGGAGGG - Intergenic
1107343236 13:39432166-39432188 ATTTCCTCACAGTTGGAGGCTGG - Intronic
1107571011 13:41658107-41658129 GTTTCCTAACAGCTAGAACATGG + Intronic
1110129876 13:71994117-71994139 TCTTTGTAACAGCTGGAGGAAGG - Intergenic
1110374569 13:74777571-74777593 TTTTCCTTCCAGCTGGAGGTGGG - Intergenic
1113923158 13:113925794-113925816 CCTTCGTAACAGCTGGAAGGCGG + Intergenic
1115491777 14:33965003-33965025 CTTTCCTGGAAGCTGGAGGGTGG + Intronic
1116559357 14:46358878-46358900 ATTTCAAAACAGCTAGAGGAGGG + Intergenic
1117080071 14:52142707-52142729 CTTTCCTTCCAACTGGAGGTGGG + Intergenic
1119228025 14:72958916-72958938 CTCTCCTAGCAGCCAGAGGATGG - Exonic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG + Intergenic
1121989407 14:98541117-98541139 GTTTGCCAACAGCTGGTGGAGGG - Intergenic
1122365571 14:101193117-101193139 CTTTCCTAGCAGATGGGGAAAGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1127187558 15:56494949-56494971 CTTTTCCAACAGCTGGATGATGG - Intergenic
1131365339 15:91834390-91834412 ATTTCCCAGCAGCTAGAGGAAGG - Intergenic
1132506369 16:311458-311480 CTTTTCTAATAGCTGGGAGAGGG - Intronic
1137385841 16:48041840-48041862 ATTCCCTAAAAGATGGAGGATGG + Intergenic
1137586420 16:49666677-49666699 CCTGCCTAACAGCTGGAGATGGG + Intronic
1139632211 16:68237555-68237577 CTTTCCCTACAGGTGGAGGCGGG + Intronic
1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG + Intergenic
1141299727 16:82802782-82802804 CTTTCCTGGCAGCTTGAAGAGGG - Intronic
1141932538 16:87215748-87215770 CTCTCCTAACACCTGCAGAAAGG - Intronic
1142415625 16:89939564-89939586 GTTTTCTAACAACTGGAGCAGGG - Intergenic
1143635116 17:8159970-8159992 CTTACATACCAGCTGGGGGAGGG + Exonic
1147051309 17:37796894-37796916 CTTTCCTGAGAGCTGTAGGGAGG + Intergenic
1147566369 17:41538785-41538807 CATTCCTAACAGCAGCTGGAAGG + Intergenic
1150730246 17:67686454-67686476 CTTGGCTAACAGCTTGAAGATGG - Intronic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1154021027 18:10664021-10664043 CTTTGCTAAGAGCTGCAGGAGGG + Intergenic
1155162682 18:23208450-23208472 CTTTATTAAAAGCTGGAAGAAGG - Intronic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1157989070 18:52473565-52473587 CTTTTCACACAGCTGGAGAAAGG + Intronic
1158103085 18:53853032-53853054 CTATCCTGGCAGCTGGGGGATGG - Intergenic
1158129515 18:54137391-54137413 CTTTTCTCAGAGCTTGAGGAGGG + Intergenic
1162017522 19:7853484-7853506 CTGGCCTAACAGGTGAAGGACGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165885369 19:39074405-39074427 GCTTCCTAACAGCTCCAGGAAGG - Intergenic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1167278012 19:48550487-48550509 CTCACCTAACAGATGCAGGAAGG - Intergenic
925723213 2:6847811-6847833 CTCCCTTAACAGCTGGAGGTGGG - Intronic
926522633 2:13934595-13934617 CTTTCCTAACATCTGTTGCAAGG + Intergenic
926564008 2:14450010-14450032 GTCTCCTGACAGCTGGAGAATGG - Intergenic
929509336 2:42554683-42554705 CTTTCCTCAAATCTGGAGGGTGG + Intronic
929821825 2:45280499-45280521 TTTGCCAAACAGCTGGACGATGG + Intergenic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
931116263 2:59170049-59170071 CTTTCTTACCAATTGGAGGAAGG + Intergenic
931514300 2:63035397-63035419 ATTTCCTAACAATTAGAGGAAGG + Intronic
931645894 2:64421698-64421720 ATTTCCTTACAGTTGTAGGATGG + Intergenic
932232469 2:70094201-70094223 ATGGCCTAACAGCTGGAGGCAGG - Intergenic
933322429 2:80794002-80794024 ATTTCCTTACAGCTGTATGAGGG - Intergenic
935985342 2:108667066-108667088 CTTTCCTGAAGGCTGGAGGGTGG + Intronic
936137773 2:109910721-109910743 CTTTCCTGAAGGCTGGAGGGTGG + Intergenic
936206924 2:110460764-110460786 CTTTCCTGAAGGCTGGAGGGTGG - Intronic
937240774 2:120460994-120461016 CTTTCCTGATAGAGGGAGGATGG + Intergenic
937383981 2:121409036-121409058 GTCTCCTAACAGCTGTAGGCAGG + Intronic
939533439 2:143393940-143393962 CATTCTTATGAGCTGGAGGATGG + Intronic
942698501 2:178675692-178675714 CTTTCTTAAGACCAGGAGGAGGG + Exonic
946049935 2:216854163-216854185 CTTTTCTAAAAGTTGAAGGAAGG - Intergenic
948309927 2:236977438-236977460 GTTTCTGAATAGCTGGAGGAGGG + Intergenic
948330959 2:237164882-237164904 CTTTCCTGACTGCTGTGGGATGG + Intergenic
1170809008 20:19659045-19659067 CTTTCGTCTCTGCTGGAGGACGG + Intronic
1171162188 20:22937585-22937607 CTTTCCTTACATCTCAAGGAAGG + Intergenic
1172018968 20:31899304-31899326 CATTCCAAACAGCAGGAGGTAGG + Intronic
1172444146 20:34984514-34984536 GCCTCCTAACAGCTGCAGGAGGG + Intronic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1176389756 21:6157426-6157448 CTTCCCTGAAAGCTTGAGGAGGG + Intergenic
1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG + Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1177859675 21:26438098-26438120 CTTTCCTAAAGGCTGCAGCATGG + Intergenic
1177910426 21:27024471-27024493 CTTTGCTAACAGATGCAGGGAGG + Intergenic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1179029193 21:37705072-37705094 CTTTCCTGACTGCAGGAGGCAGG - Intronic
1179187676 21:39097236-39097258 CTTTTCTAACTGCTGCAGGGAGG - Intergenic
1179190355 21:39117618-39117640 CTGTCCTAACAGCAGCAGGGTGG - Intergenic
1179733711 21:43380812-43380834 CTTCCCTGAAAGCTTGAGGAGGG - Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1181881964 22:25988386-25988408 CTTCCCTAGCAGATGGAGGATGG + Intronic
1182681069 22:32080390-32080412 CTTTGCTAACTGATGGAGGGAGG + Intronic
1184710368 22:46246136-46246158 CTTTTCTAAGAACTGCAGGAGGG - Intronic
950328862 3:12139759-12139781 CTTACCTAACAGGTAGAGTATGG + Intronic
951891987 3:27576050-27576072 CTTCCCTGAAAGCTGGGGGATGG + Intergenic
952720466 3:36526915-36526937 CTATCCTAATAGCTGTAGCAAGG - Intronic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
953415374 3:42712609-42712631 CTTTCCCATCAGCAGCAGGAAGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955496959 3:59543271-59543293 CTTCCCTAAGAGCTGGATCAGGG - Intergenic
957562713 3:81844062-81844084 GTTTCCTAACTGCTGGAAAAGGG + Intergenic
958177995 3:90021606-90021628 CAATCCTAGCAGCTGGGGGATGG + Intergenic
961491209 3:127257863-127257885 CTGCCCTGACAGCTGGAGGCTGG - Intergenic
961925556 3:130475975-130475997 CTTTACCAACATCTGGAGGAAGG + Intronic
962365369 3:134775542-134775564 CAATACTCACAGCTGGAGGATGG + Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
967085983 3:186095834-186095856 CTTCCCCACCAGCTGGAGGCTGG + Intronic
970522162 4:16896527-16896549 TGTTCCTAACTGCAGGAGGATGG + Intronic
970569771 4:17368336-17368358 TTTTCCTGACAGCTGTTGGATGG + Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
972340259 4:38146537-38146559 CTTCCCCAGGAGCTGGAGGAGGG - Intergenic
972786870 4:42334534-42334556 CTTTTCTCCCAGCTGGATGAAGG + Intergenic
974119208 4:57618392-57618414 TTTTCGTAACATTTGGAGGAAGG - Intergenic
976442653 4:85093412-85093434 CTTTCTTGAGAGTTGGAGGAGGG - Intergenic
978774025 4:112487597-112487619 CATTCCCAACAGCTGAAAGAGGG + Intergenic
979252551 4:118580578-118580600 CTTTCCCAACAGCTGGATGAGGG + Intergenic
981015126 4:139966375-139966397 AGTTCCTAACATCTGGAGAATGG - Intronic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
991575608 5:68100230-68100252 CTTTCCTTACAGCTAGGGCAGGG + Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
995182198 5:109239574-109239596 TCTTTCTAACAGCTGTAGGATGG + Intergenic
998386032 5:141757673-141757695 CTTTTCTAGGAGCTGGAGCAGGG + Intergenic
998501919 5:142640591-142640613 CTTGGATAACAGCTGGAAGAAGG - Intronic
1000895037 5:166845277-166845299 CTTTCCTATCACTTGGAGGCGGG + Intergenic
1001879455 5:175230799-175230821 GTTTCCTGACAGCTGGCCGAGGG - Intergenic
1002762972 6:216076-216098 CATTCTTAACAGCTGGACAATGG + Intergenic
1002998723 6:2311274-2311296 ACTTCCTAGCAGCTGAAGGAGGG - Intergenic
1003171282 6:3723695-3723717 TTTCCCTCAGAGCTGGAGGACGG - Exonic
1003455623 6:6279084-6279106 CTTTCCTAAAAGCTGGAACTGGG + Intronic
1004879977 6:19997796-19997818 GGTTACTAGCAGCTGGAGGAAGG + Intergenic
1006101291 6:31687823-31687845 GCCTCCTCACAGCTGGAGGAAGG - Exonic
1006155550 6:32011155-32011177 GTCTCCTACCAGCTGGCGGACGG - Intergenic
1006161882 6:32044009-32044031 GTCTCCTACCAGCTGGCGGACGG - Exonic
1006254612 6:32820482-32820504 CTTCCCTCAGAGCTGAAGGAAGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006996371 6:38264925-38264947 GTCTCCTAATAGCAGGAGGAGGG + Intronic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1012229784 6:96747393-96747415 CTTCCATATCATCTGGAGGAAGG - Intergenic
1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG + Intronic
1015701025 6:136036418-136036440 CCTTCCTAACAGGTGAAGAAGGG - Intronic
1015886576 6:137924245-137924267 ATTACCTTACAGCTGGTGGAGGG - Intergenic
1016184042 6:141178844-141178866 CTTCCATAGCTGCTGGAGGAAGG - Intergenic
1016999850 6:149989014-149989036 CTTCTATAACAGCAGGAGGATGG - Intergenic
1018422648 6:163652753-163652775 CTTTCCTAACAGCTCCATGCTGG + Intergenic
1018832133 6:167451298-167451320 CTTTCTTGAGACCTGGAGGAAGG - Intergenic
1019294935 7:269063-269085 CCTTCCTGGCTGCTGGAGGACGG + Intergenic
1019730729 7:2627945-2627967 CCTTCCTGGCAGCTGGAGGGAGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020690277 7:11346484-11346506 CTTTCTTACCAGCTGGGGCAAGG - Intergenic
1022008271 7:26287305-26287327 TTTTCCCAAGAGATGGAGGAAGG + Intergenic
1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG + Intronic
1032640461 7:133760628-133760650 CTTTCCTAAAAGCTCCAGAATGG - Intronic
1038439659 8:27562549-27562571 CTTGCCTAACAGCTGGTGCAAGG - Intergenic
1039542444 8:38382763-38382785 CTTCCCTGACAGCCGTAGGACGG - Intergenic
1040035122 8:42862667-42862689 CTTTCCAAACAGCTAAAAGAAGG + Intronic
1040464054 8:47678388-47678410 CTTTTCCCACAGCTGAAGGAAGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041730054 8:61053771-61053793 ATTTCCTGACAGCTCCAGGACGG - Intergenic
1042663747 8:71183533-71183555 CTTTTCTAAAACCTGGAGAAGGG - Intergenic
1042768927 8:72357334-72357356 CTTTCCTTTAAGCTGGATGATGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047443015 8:124895741-124895763 TTTTCCTAACATTTGGAGGAAGG - Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1056033991 9:82584506-82584528 CTTTCCTAACAGCCGGTTTATGG + Intergenic
1058565398 9:106279042-106279064 CTTTCCTAACAGTTGGTGTCAGG + Intergenic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1058808423 9:108615941-108615963 CTTTCCTAATCACTGGAGGCAGG + Intergenic
1059438708 9:114290798-114290820 CTTTCTTAACAGGGGGAGCAGGG + Exonic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1060859814 9:126945122-126945144 CTTCCCTTGCAACTGGAGGAAGG - Intronic
1061727017 9:132587595-132587617 CTTTCCTCACAGCTCCTGGAGGG + Intronic
1061910115 9:133717812-133717834 CTTCCCAAAGAGCTGCAGGAAGG - Intronic
1062243835 9:135553177-135553199 GTTTCCTAAAAGCTGGTGGGTGG - Intergenic
1185993759 X:4920906-4920928 CTTTCATAAGAGCTCAAGGATGG + Intergenic
1187029661 X:15472644-15472666 GGTTCCTAGGAGCTGGAGGAAGG + Intronic
1187200566 X:17130119-17130141 TTTTATTAACAGCTGAAGGAGGG - Intronic
1189612828 X:42754991-42755013 CATTCCTGGCAACTGGAGGAAGG + Intergenic
1189667514 X:43372772-43372794 CATTCATAGCAGCTGGAGAATGG - Intergenic
1190877381 X:54469779-54469801 ACTTCTCAACAGCTGGAGGAGGG - Intronic
1195324496 X:103747304-103747326 CTTTACTAACAACTGGAGTGAGG + Intergenic
1195703165 X:107720133-107720155 TTTTCCTAAAAGCTGGAATAGGG - Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1199061744 X:143363759-143363781 CTTTTCCAACAGCTGTTGGAGGG - Intergenic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic