ID: 1020004036

View in Genome Browser
Species Human (GRCh38)
Location 7:4772215-4772237
Sequence GGTACTCGTTGCTGCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020004021_1020004036 23 Left 1020004021 7:4772169-4772191 CCCTGCCCCTGGCACACGCCCAC 0: 1
1: 0
2: 0
3: 28
4: 363
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004023_1020004036 18 Left 1020004023 7:4772174-4772196 CCCCTGGCACACGCCCACATCCT 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004020_1020004036 24 Left 1020004020 7:4772168-4772190 CCCCTGCCCCTGGCACACGCCCA No data
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004032_1020004036 5 Left 1020004032 7:4772187-4772209 CCCACATCCTGGCTGGGGGGCAC 0: 1
1: 0
2: 4
3: 19
4: 193
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004024_1020004036 17 Left 1020004024 7:4772175-4772197 CCCTGGCACACGCCCACATCCTG 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004034_1020004036 -2 Left 1020004034 7:4772194-4772216 CCTGGCTGGGGGGCACTTGCAGG No data
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004018_1020004036 29 Left 1020004018 7:4772163-4772185 CCAACCCCCTGCCCCTGGCACAC No data
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004019_1020004036 25 Left 1020004019 7:4772167-4772189 CCCCCTGCCCCTGGCACACGCCC 0: 1
1: 0
2: 5
3: 54
4: 689
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004025_1020004036 16 Left 1020004025 7:4772176-4772198 CCTGGCACACGCCCACATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 278
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004033_1020004036 4 Left 1020004033 7:4772188-4772210 CCACATCCTGGCTGGGGGGCACT No data
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data
1020004022_1020004036 22 Left 1020004022 7:4772170-4772192 CCTGCCCCTGGCACACGCCCACA No data
Right 1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020004036 Original CRISPR GGTACTCGTTGCTGCCCCAG TGG Intronic