ID: 1020004560

View in Genome Browser
Species Human (GRCh38)
Location 7:4775491-4775513
Sequence AGGTGCCGCGGCCGGGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 4, 2: 1, 3: 16, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020004560_1020004575 19 Left 1020004560 7:4775491-4775513 CCGGACCCCCGGCCGCGGCACCT 0: 1
1: 4
2: 1
3: 16
4: 282
Right 1020004575 7:4775533-4775555 CCACGCCAAAGCCCATTGGTCGG 0: 1
1: 0
2: 1
3: 6
4: 71
1020004560_1020004573 15 Left 1020004560 7:4775491-4775513 CCGGACCCCCGGCCGCGGCACCT 0: 1
1: 4
2: 1
3: 16
4: 282
Right 1020004573 7:4775529-4775551 CGCTCCACGCCAAAGCCCATTGG 0: 1
1: 0
2: 0
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020004560 Original CRISPR AGGTGCCGCGGCCGGGGGTC CGG (reversed) Intronic
900185848 1:1332903-1332925 AGGAGCTGCGGGCGGGGGACGGG - Exonic
900965045 1:5952037-5952059 AGGTGCCCAGGCAGGGCGTCTGG - Intronic
901373199 1:8817768-8817790 GTGTGACGCGGCCGGGGGCCCGG + Intergenic
902409853 1:16206410-16206432 AGGTGTGGCGTCCTGGGGTCTGG - Intronic
902516000 1:16989948-16989970 AGGTGCCTGGATCGGGGGTCTGG + Exonic
903044010 1:20552675-20552697 AGGGGCCGGGGCTGGGGGTGAGG - Exonic
903263292 1:22142719-22142741 AGGTGTCTCGGCCGCGGGACCGG - Intronic
903606353 1:24577840-24577862 AGATGCATGGGCCGGGGGTCGGG + Intronic
905800216 1:40838247-40838269 AGGGGACGCGGCCGGGGGCGGGG - Intronic
905960103 1:42035955-42035977 AGGGGGCGGGGCCCGGGGTCTGG - Intergenic
907240180 1:53076938-53076960 AGGGGCCTCTGCCAGGGGTCAGG + Intronic
907391496 1:54161202-54161224 AGGGGCCGCGGACGGGGCTGGGG + Intronic
912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG + Exonic
913680915 1:121186526-121186548 AGGTGCCCCGGCCGGGGGTCTGG + Intronic
914032745 1:143974165-143974187 AGGTGCCCCGGCCGGGGGTCTGG + Intergenic
914156699 1:145093800-145093822 AGGTGCCCCGGCCGGGGGTCTGG - Intronic
915973601 1:160370830-160370852 TGGTGCCGGGCCTGGGGGTCCGG + Exonic
916091918 1:161314327-161314349 AGGCGCGCCGGCTGGGGGTCGGG - Exonic
916714542 1:167438347-167438369 GGGTGCCACGTCCGGGGGTGAGG + Intronic
918024625 1:180731326-180731348 AGGTGCTGCGGCCGAGGGGATGG + Intronic
920468228 1:206205050-206205072 AGGTGCCCCGGCCGGGGGTCTGG + Intronic
921320561 1:213934447-213934469 AGGTGGCGGGGCCTGTGGTCTGG - Intergenic
923035130 1:230280276-230280298 CGGGGCCGAGGCCGGTGGTCTGG - Exonic
923591906 1:235327542-235327564 AGCGGCCGCGGTCGGGGGCCCGG - Intronic
924527148 1:244863305-244863327 AGGAGCCGCGGGCGGGCGGCGGG - Intronic
1062799289 10:367903-367925 AGGTGCCTCCGACGGGGGCCCGG + Intronic
1062799307 10:367961-367983 AGGTGCCTCCGACGGGGGCCCGG + Intronic
1062799324 10:368019-368041 AGGTGCCTCCGACGGGGGCCCGG + Intronic
1062799341 10:368077-368099 AGGTGCCTCCGACGGGGGCCCGG + Intronic
1062799358 10:368135-368157 AGGTGCCTCCGACGGGGGCCCGG + Intronic
1062799375 10:368193-368215 AGGTGCCTCCGACGGGGGCCCGG + Intronic
1067048856 10:43000732-43000754 AGGTCACGCGGCTGGGTGTCAGG - Intergenic
1067779631 10:49190397-49190419 AGGTGCCGTGGCTGGGTGCCAGG - Intergenic
1069088517 10:64170986-64171008 AGGTACCGCGTCTGTGGGTCGGG + Intergenic
1069849613 10:71396713-71396735 CGGCGCCGCTCCCGGGGGTCCGG + Intergenic
1070933383 10:80276069-80276091 AGGTGCAGCAGCCGTGGGTAAGG + Intronic
1071966524 10:90857836-90857858 ACCCGCAGCGGCCGGGGGTCCGG - Intergenic
1074165815 10:110872512-110872534 CGGGGCCGAGGCCGGGGCTCCGG - Intronic
1075522030 10:123148745-123148767 AGCTGCGGCAGCCGGGGGTTCGG + Intronic
1076316416 10:129544929-129544951 AGGCGGCGTGGCCAGGGGTCAGG + Intronic
1076499364 10:130924326-130924348 AGGTCCTGCGGCCTGGGGCCGGG - Intergenic
1076657912 10:132036756-132036778 TGGGGCCGCGACCGGGGGCCGGG + Intergenic
1076680579 10:132169412-132169434 AGGTGCCGGGGCCGAGTGTGGGG - Intronic
1076770075 10:132657952-132657974 AGGTGCTGGGGCCGGGGAGCAGG - Intronic
1076874169 10:133207885-133207907 TGGTGGGGCGGCCGGGGGTCTGG - Intronic
1076905833 10:133360512-133360534 AGGTGCCACGCCCGTGTGTCCGG - Intergenic
1077060900 11:617528-617550 AGGAGCGGCGGCCGGAGGGCGGG - Exonic
1077063505 11:627491-627513 AGGGGCTGCGGCCGGAGTTCCGG + Intergenic
1077252135 11:1565376-1565398 GGGTGCTGCGGGCGGGGGTGCGG + Intronic
1077444366 11:2583466-2583488 AGGTGCCCCAGACGTGGGTCGGG + Exonic
1077491388 11:2862448-2862470 GGGGGCCGGGGTCGGGGGTCCGG + Intergenic
1078164488 11:8870847-8870869 CGCTGCCGGGGCCGGGAGTCGGG + Intronic
1080472938 11:32563834-32563856 AGGTTCCGCTGCAGGAGGTCAGG - Intergenic
1081831875 11:46121436-46121458 AGGTGCTGCGGCCCGGGGCCGGG - Intergenic
1082028853 11:47590735-47590757 AGGATCCCGGGCCGGGGGTCGGG + Exonic
1083583400 11:63839377-63839399 ATGGGCCCCGGCCGGGGGTGCGG - Exonic
1083960448 11:66012283-66012305 AGGTGCGGCGGGCGGGGTGCTGG + Exonic
1084315668 11:68343895-68343917 ATGTGCCGGGGCCTGGGGGCAGG + Intronic
1084758304 11:71252538-71252560 AGGAGCCGCCGCCGCGGCTCAGG + Intronic
1089499911 11:118925797-118925819 TGGTGCAGCGGCCCCGGGTCCGG + Intronic
1092143803 12:6201097-6201119 GGGTGCCTCGGCCGCGGGTCCGG + Intronic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1095958669 12:47820152-47820174 CGGAGCCGCGGCCGGCGTTCCGG - Intronic
1096241292 12:49961673-49961695 GGCTGCCCCGGCCGGGGGGCGGG + Intergenic
1096520092 12:52180202-52180224 AGGTGCCTCGGACAAGGGTCAGG - Intronic
1096812760 12:54182285-54182307 AGGTGCAGCTGCTGGGGGTGCGG - Exonic
1098029038 12:66235379-66235401 AGCTGCCTCGGCCCGGGGCCCGG - Intronic
1098747892 12:74263988-74264010 AGGTGCCACCCCAGGGGGTCTGG - Intergenic
1102421678 12:112808338-112808360 AGCTGCCGCGGCTGGGGCTGAGG - Intronic
1103321677 12:120095941-120095963 AGGTGTCCGGGCTGGGGGTCGGG + Exonic
1103476446 12:121222279-121222301 AGGTGCCGAGGCTGGGGTCCTGG + Intronic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104624016 12:130338192-130338214 GGGGGCGGCGGCTGGGGGTCCGG + Intronic
1104895830 12:132163186-132163208 AGGTGACGCGGCCATGGGTGAGG - Intergenic
1104975223 12:132549162-132549184 CGTCGCCGCGGCCTGGGGTCTGG + Intronic
1105015867 12:132786627-132786649 AGGTGCGGGGGCCGGGGGGGAGG - Intronic
1106269373 13:28138737-28138759 TGGTGGCCCCGCCGGGGGTCGGG + Exonic
1106410111 13:29505746-29505768 AGGGGCGGCGGTCGGGGGGCAGG - Exonic
1112558529 13:100491693-100491715 AGGTGCTGCGGCCTGGTGGCTGG + Intronic
1113430741 13:110248374-110248396 AGGAGCCGGGGCCAGGGGCCAGG - Intronic
1113744524 13:112734267-112734289 AGGTGCAGGGGGCGGGGGTGAGG + Intronic
1113931663 13:113972031-113972053 AGGTGCCGCAGCAGGGAGGCCGG - Intergenic
1118809107 14:69260764-69260786 CGCTGCCGGGGCCGGGAGTCTGG + Intronic
1120190566 14:81436240-81436262 AGGTGGAGCGGGCGGGGGGCGGG - Intronic
1120823016 14:88930421-88930443 GTGTGCTGCGGCTGGGGGTCAGG - Intergenic
1121114370 14:91332986-91333008 AAGAGCCTCGGGCGGGGGTCGGG + Intronic
1121779120 14:96610549-96610571 AGGTGCCCCGGGTTGGGGTCAGG + Intergenic
1122549137 14:102540386-102540408 AGGAGCCAAGGCCGGGGGTGGGG + Intergenic
1122558088 14:102592276-102592298 AGGGGCCGCGGCCAAGGGTAGGG + Intergenic
1122582165 14:102777679-102777701 AGGGGCCGCGGCGGGCGGGCGGG + Intronic
1122693987 14:103544081-103544103 AGGTGTCGGGGCTGGAGGTCAGG - Intergenic
1122720034 14:103716479-103716501 CGGTGCCGCGGGCGGGTGGCCGG + Intronic
1122744672 14:103890737-103890759 AGGAGCCCCGGCCCAGGGTCGGG - Intergenic
1123047798 14:105527045-105527067 AGGGGCCTCGGCCGGGGCCCAGG + Intronic
1123119074 14:105908710-105908732 AGGTCCCGGGCCTGGGGGTCTGG + Intergenic
1124190710 15:27574257-27574279 AGGTGGCGCTGCGGCGGGTCGGG + Intergenic
1125463318 15:39926714-39926736 AGGTGGCGGGGCCGGGGCCCTGG + Intergenic
1127884818 15:63189756-63189778 AGGGGCCGCGGCCCGGGACCGGG + Intronic
1128454228 15:67823586-67823608 AGGAGCGGCGGGCGGGAGTCCGG - Intronic
1129082572 15:73052997-73053019 AGGGGCGGCTGCCGGGGGGCAGG + Intronic
1129155836 15:73717027-73717049 AGGAGCCTGGGCTGGGGGTCAGG + Intergenic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1129675934 15:77632506-77632528 CGGAGCCGGGGCCGGGGCTCGGG + Intronic
1130766259 15:86874553-86874575 AGGTGCTGTGGCAGGGGCTCAGG - Intronic
1132560196 16:590044-590066 CGGCGGCGCGGCCGGGGGTGGGG + Intronic
1132730004 16:1356504-1356526 AGGGGCCGTGGCCGGGGTTCTGG + Intronic
1133021724 16:2969867-2969889 AGGTAGGGCGGCCGGGGGTGTGG - Intronic
1133259427 16:4538561-4538583 AGGCGCCGCGGGCGGGGGCGGGG + Intronic
1134438835 16:14285634-14285656 AGGTCCCGCGGGCGGGGCACCGG - Intergenic
1135324989 16:21520502-21520524 AGGAGCCGCGGACGGTGGGCGGG - Intergenic
1135335859 16:21600074-21600096 CGGGGCCGCGGCCGGGTGCCCGG - Intronic
1136336470 16:29613770-29613792 AGGAGCCGCGGACGGTGGGCGGG - Intergenic
1136498792 16:30659530-30659552 AGCGGCCGCGGCCCCGGGTCCGG + Exonic
1136579614 16:31143440-31143462 AGGCCCCGCGGCCAGGGGCCTGG - Exonic
1136627820 16:31472502-31472524 AGGGGCCTCGGCCCGGGGACCGG + Intronic
1136858635 16:33681131-33681153 GGGTCCCGGGGCCGGGGGTGGGG + Intergenic
1136927505 16:34388569-34388591 AGGTGGCGGGGGCGGTGGTCAGG + Intergenic
1136977069 16:35023237-35023259 AGGTGGCGGGGGCGGTGGTCAGG - Exonic
1137531708 16:49282238-49282260 AGGCGGCGCGCCCCGGGGTCGGG + Intergenic
1141531369 16:84648807-84648829 GGGCGCCGCGGCCGGGGGAGGGG + Intronic
1141764930 16:86051971-86051993 CGCTGCCACGGCCGGGTGTCAGG - Intergenic
1141839245 16:86564066-86564088 AGGTGCAGCGGCCACGGGCCGGG + Intergenic
1141946937 16:87317149-87317171 AGGCGCTGCTGCCGGGGGGCCGG - Exonic
1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG + Intronic
1142037193 16:87869552-87869574 AGGAGCCGCGGACGGTGGGCGGG - Intergenic
1142145085 16:88489555-88489577 AGGTGCCCAGGCAGGCGGTCAGG + Intronic
1142248727 16:88981395-88981417 AGGTGCCATGGCCGGAGGGCTGG + Intergenic
1143107261 17:4535998-4536020 AAGTGCCACGGCCCGGGGCCAGG + Intronic
1143747306 17:9003691-9003713 AGGCGCCGGGGCCGGGGCACCGG - Intergenic
1147948206 17:44092375-44092397 AGGTGCCGGGCCTGGGGGTAAGG - Exonic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148798123 17:50207144-50207166 AGGGGGCGTGGCCGGGGGGCGGG + Intergenic
1151301858 17:73232628-73232650 AGGTTCCTTGGCCGGGGGTTGGG + Exonic
1151812456 17:76452704-76452726 AGGTGCGGCGGGCGGGGGCTGGG - Exonic
1151933500 17:77247617-77247639 AAGTCCCACCGCCGGGGGTCGGG + Intergenic
1152579659 17:81160341-81160363 AGGGACCGGGGCCTGGGGTCAGG - Intronic
1152665365 17:81565474-81565496 GGGTGCCGGGGCAGGGGGTGGGG + Intronic
1152683414 17:81681930-81681952 AGGTGGTGCAGCTGGGGGTCCGG - Intronic
1154197445 18:12276924-12276946 AGCTGCCGTGGCAGTGGGTCTGG - Intronic
1155519886 18:26657048-26657070 AGGGGCCGCGGCCGGGGGCCGGG - Intronic
1157261013 18:46175122-46175144 GGCTGCCGGGGACGGGGGTCGGG - Intronic
1157687034 18:49650953-49650975 AGGTGCGGCGGCTGGGGGTTCGG + Intergenic
1160164052 18:76495119-76495141 AGGGGCCGCGGGCGGGGGGAGGG - Intronic
1160454690 18:78992425-78992447 AGGGGCCGCAGGCGGGGGCCGGG - Exonic
1160548622 18:79679265-79679287 AGCTCCCGCGGCGTGGGGTCCGG + Intergenic
1160855380 19:1214962-1214984 AGATGCGGTGGCCGGGGGGCGGG - Intronic
1161313245 19:3606566-3606588 GGATCCCGCGCCCGGGGGTCCGG + Exonic
1161412510 19:4124198-4124220 AGGCGCGGCGGCTGGGGGTGGGG - Intergenic
1161441240 19:4292741-4292763 AGGTGCGGCTGGCGGGGGGCCGG + Exonic
1161473553 19:4472881-4472903 AGGAGCCGCGCCCCGGGGTCTGG + Intronic
1161924882 19:7293315-7293337 GGGTGACGCTGCCTGGGGTCAGG - Intronic
1161984928 19:7647806-7647828 AGGGGGCGGGGCCAGGGGTCAGG - Exonic
1163160043 19:15458781-15458803 AGGTGCCATGGCGGGGGGTGGGG - Intronic
1163503206 19:17688153-17688175 AGGAGGCGAGGCTGGGGGTCGGG - Intronic
1165319244 19:35075596-35075618 AGGTGGCGTGGATGGGGGTCTGG + Intergenic
1165712666 19:38023246-38023268 AGGCGGTGGGGCCGGGGGTCAGG + Intronic
1166727459 19:45037607-45037629 AGGTGCCGGGGCCGTGGTTGGGG + Exonic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167457047 19:49601766-49601788 AGATGCAGGGGCCGGGTGTCCGG - Exonic
1167591884 19:50408752-50408774 AGCAGCCGCGGCCGGGAGTCAGG - Intronic
1168277108 19:55284398-55284420 AGGGGGGGCGGCCGGGGGACCGG + Exonic
1168718938 19:58544436-58544458 AAGAGCCGAGGCCGGGGGGCGGG - Intronic
925034807 2:677047-677069 GGGGGCCGGGGCCGGGCGTCGGG - Intronic
925380683 2:3423508-3423530 GGGTGCCGGGGCTGGGGGTGGGG - Intronic
926095853 2:10080266-10080288 AGGGGGCGCGGCCGGGGGCGGGG + Exonic
926155025 2:10448686-10448708 AGCTGCCGCGGGCCGGGGCCGGG - Intergenic
926695042 2:15765226-15765248 AGGTGCCTGGGGCTGGGGTCTGG + Intergenic
927151101 2:20196689-20196711 AGGTGCCCAGGCCCGGCGTCTGG - Intergenic
927517632 2:23681406-23681428 AGGTGTCACGGCCGGGGCTGGGG + Intronic
929775387 2:44928355-44928377 CGGAGCGGCGGCCGGGGGTCGGG - Intergenic
932191040 2:69741877-69741899 AGGGGGCGAGGCCGGGGGACCGG + Intronic
932215577 2:69963898-69963920 AGGCGCCGGGGGCAGGGGTCTGG + Intergenic
934127751 2:88915162-88915184 AGGTTCAGCGGCAGTGGGTCTGG - Intergenic
934882329 2:97995374-97995396 AAGGGCCGCGGCCGGGGCTCCGG - Intronic
937214199 2:120300713-120300735 AGGTGCTGCGGCCTGGGAGCAGG + Intergenic
941020955 2:160407620-160407642 AGCTGCCGCGGCCCCGGGCCCGG - Intronic
941112352 2:161428377-161428399 AAGGGCCGCGGCCTGGGCTCTGG + Intronic
942748659 2:179264435-179264457 AGGCCCCGCGGCCGGGTGGCCGG - Intronic
943302796 2:186224154-186224176 AGGAGCCACGGCCTGGAGTCAGG - Intergenic
944154046 2:196592847-196592869 GGGCGCCGGGGCCGCGGGTCCGG - Intronic
945478380 2:210314971-210314993 AGGTGCCGGTGCCGGGGCTGGGG + Exonic
946310570 2:218880660-218880682 AGGTGCAGCGGGCTGGGGACGGG - Exonic
946370652 2:219279514-219279536 AGGAGGTGCGGCCGGGGGCCCGG + Exonic
948862110 2:240757653-240757675 AGGGGCCGGGGCCGGGGCTGGGG + Intronic
1169427088 20:5504720-5504742 AGGAGGCCAGGCCGGGGGTCAGG + Intergenic
1169673800 20:8132495-8132517 AGGTGCGGAGGCCGGGAGGCCGG + Intronic
1170015354 20:11775367-11775389 AGGTGCAGGGGCGGGGGGGCGGG - Intergenic
1171364347 20:24613571-24613593 AGGTGCCAAGGCAGGGGGTGCGG - Intronic
1173752408 20:45487558-45487580 AGGTGCAGAGGCCAGGTGTCCGG - Intergenic
1175847068 20:62064926-62064948 GGGCGCGGCGGTCGGGGGTCCGG + Exonic
1176068851 20:63215825-63215847 AGGGGCCGCGGCCGGGGCCGAGG - Intronic
1178916455 21:36708023-36708045 AGGGGTCGCAGCCAGGGGTCGGG + Intronic
1179522241 21:41953314-41953336 AGATGCCGGGGCGGGCGGTCCGG - Intronic
1179891635 21:44338682-44338704 AGGGGAGGAGGCCGGGGGTCGGG - Intronic
1180920743 22:19520258-19520280 AGGTGCCCGGGCCAGGGGGCAGG + Intronic
1180927520 22:19566630-19566652 GTGCGCGGCGGCCGGGGGTCAGG - Intergenic
1181317222 22:21978560-21978582 AGGAGCCCAGGCTGGGGGTCGGG + Intronic
1181745461 22:24952716-24952738 AGGTGCCGCGGGCTGCGGGCAGG + Intronic
1182097346 22:27634928-27634950 GGGTGCAGCGGCAGGGGGACAGG - Intergenic
1182116111 22:27757434-27757456 AGCTGCCGAGGCTGGGGGTCAGG + Intronic
1182549129 22:31091549-31091571 AGGTGCTGCGGCCAGGACTCAGG + Intronic
1182586143 22:31345350-31345372 CGGAGCTGCGGACGGGGGTCCGG - Exonic
1184095522 22:42314330-42314352 AGCTGCCGCTGCCGGGGGACAGG + Intronic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
950102245 3:10365126-10365148 AGGAGCCGAAGCAGGGGGTCTGG + Intronic
954707631 3:52489509-52489531 AGGGGCCTCGGCTGGGGGTGGGG - Exonic
961096060 3:124157911-124157933 AGGTGCAGTGGCTGTGGGTCTGG + Intronic
961369911 3:126422863-126422885 AGGTGCAGAGGCCTGGGGTAGGG + Intronic
963880259 3:150520589-150520611 GGGTGGCGCGGCCGGGGTTTGGG - Intergenic
967730714 3:192904500-192904522 AGGGCCCGGGGCCGAGGGTCTGG - Intronic
968433966 4:575726-575748 GGGGGCCGCGGCCGGGGCCCCGG - Intergenic
968443739 4:637631-637653 AGGAGCCGCGGCCTGGGGGCCGG + Intronic
968476883 4:814824-814846 AGGGGCCCCGGCCATGGGTCGGG + Intronic
968674984 4:1872051-1872073 CGGCGCCGGGGCCAGGGGTCGGG + Intronic
968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG + Intronic
968764158 4:2459408-2459430 ATGTGCCGCGGGCCTGGGTCTGG + Intronic
969402331 4:6963635-6963657 AGGTGCTGTAGCCTGGGGTCTGG - Intronic
969696696 4:8738902-8738924 CGGTGCTGCAGCCGGTGGTCAGG - Intergenic
975830327 4:78362371-78362393 AGGTGCCGCTGCCATGAGTCCGG - Intronic
975986182 4:80202911-80202933 AGGCGGCGCGGGCGGGGGCCAGG + Exonic
976751980 4:88457854-88457876 AGATGCGGCGGGCGGGGGACGGG - Intronic
980075150 4:128287235-128287257 AGGTGCGGCGGCCGAGGCGCGGG + Intronic
985790983 5:1926652-1926674 AGGTGCTGGGGCCGGGGCTGGGG - Intergenic
989230114 5:39075036-39075058 GGGTGCAGCGGCCGGGGACCAGG + Intergenic
989613005 5:43313295-43313317 AGGTGCCGCGGGCGGGGTGTGGG - Intronic
992716311 5:79514229-79514251 CGGAGCCGCGGCCGGGGGCTGGG + Intergenic
992775198 5:80083004-80083026 CTGAGCCGCGGGCGGGGGTCCGG + Intronic
996784984 5:127228898-127228920 AGGTGCGGCCGGCGGGGGACAGG - Intergenic
998018841 5:138753371-138753393 GGGGGCCGCGGGCGGGGGGCGGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1002524243 5:179806682-179806704 AGGGGCCCCGGCCCCGGGTCGGG + Intronic
1005320224 6:24646134-24646156 AGCTGCCGCGGGCGGTGGGCGGG - Exonic
1006303885 6:33207833-33207855 AGGAGCCGCGGCCCGGGGCGGGG - Intergenic
1006364971 6:33609995-33610017 AGGTGCTGGGGCTGGGTGTCGGG - Intergenic
1006408340 6:33857787-33857809 AGGTGCCTGGGAAGGGGGTCTGG + Intergenic
1008469633 6:51869350-51869372 AGGGGCCGAGGAAGGGGGTCAGG - Intronic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1013048810 6:106512351-106512373 AGGTCCAGCGGCCGTAGGTCGGG + Exonic
1014073867 6:117214989-117215011 GGGTGCCACGGCCTGGAGTCAGG + Intergenic
1017812138 6:157990971-157990993 AGGTGCTGAGGGCTGGGGTCTGG - Intronic
1017842427 6:158232436-158232458 GGGCGCGGCGGGCGGGGGTCGGG + Intronic
1018911183 6:168101558-168101580 GGGTGACGCGGCCCGGGGTCCGG + Intergenic
1019171769 6:170136867-170136889 AGGTGGCGAGGCCGTGGATCCGG - Intergenic
1019298359 7:290632-290654 AGCTGCGGAGCCCGGGGGTCAGG - Intergenic
1019374203 7:680509-680531 ACGTGCCGAGGCCTGGGGACAGG + Intronic
1019474339 7:1236736-1236758 AGGCGCCGGGGCCGGGGCTGGGG - Exonic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020100015 7:5389253-5389275 AGTGGCCGCCGCCAGGGGTCCGG + Exonic
1020106362 7:5423949-5423971 ATGCGCGGCGGCCGGGGGCCGGG - Intronic
1020125314 7:5530039-5530061 GGGTGCCGCGGCCTGGGCTGGGG - Intronic
1020130498 7:5556334-5556356 AGGGGCCGCGGGCCGGGGGCGGG - Intronic
1022207751 7:28180227-28180249 AGGTGCCGCGGGCGGGCGGGCGG - Intronic
1023923046 7:44644927-44644949 AGGTGCTGGGGCCGGGGGGAAGG + Intronic
1029390645 7:100271958-100271980 AGCTGCCGCGGACGGGGCGCGGG - Exonic
1029540701 7:101180393-101180415 TGCTGGCGGGGCCGGGGGTCGGG + Intergenic
1029701453 7:102249042-102249064 AGGGGCCGCGGCCCTGGGGCGGG + Exonic
1032279172 7:130486951-130486973 TGGTGGCGCGGCTGGGGGCCTGG + Intronic
1034444863 7:151108617-151108639 AGGTGACGCGGCTGGCAGTCTGG - Intronic
1036466561 8:9003122-9003144 AGTCGCCGCGGCCGGAGGGCGGG + Exonic
1036708060 8:11059672-11059694 AGGTGCGGCGGGCGCGGGGCGGG + Intronic
1037799348 8:22024142-22024164 AGGCGCCGCGGCAGGGGGCGGGG - Exonic
1040308943 8:46226712-46226734 GGGTGCCGTGGCCAGGCGTCAGG + Intergenic
1040546165 8:48399598-48399620 AGGTGGCGTGGCCGGTGGACAGG - Intergenic
1041167136 8:55101910-55101932 AGGAGCGGCGGGCGGGGGTTGGG - Intergenic
1041292413 8:56319992-56320014 AGGTCGCGCTGGCGGGGGTCGGG - Intronic
1041690272 8:60680037-60680059 AGCTGCCGCCGCCGGCGGCCCGG - Intronic
1043891224 8:85654470-85654492 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043892298 8:85661307-85661329 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043893263 8:85716033-85716055 AGGGGCCGCGGCAGGGATTCCGG - Intergenic
1043895946 8:85737482-85737504 AGGGGCCGCGGCAGGGATTCCGG - Intergenic
1043896733 8:85744326-85744348 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043899056 8:85762693-85762715 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043900667 8:85774887-85774909 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043902631 8:85790162-85790184 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043904241 8:85802355-85802377 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043905853 8:85814549-85814571 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043907461 8:85826736-85826758 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1045098983 8:98825980-98826002 CGGTGCCGCGGCGGGTGGGCGGG + Intronic
1045277736 8:100722324-100722346 AGGCGCCGCGGCCGGGGAAGCGG + Exonic
1045432048 8:102123810-102123832 CGGGGCCGGGGCCGGGGGCCGGG - Intronic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1048395612 8:134011310-134011332 AGGTGCAGGGGGCGGGGCTCTGG + Intergenic
1048831244 8:138479334-138479356 AGGTTGGGAGGCCGGGGGTCTGG + Intronic
1049562898 8:143320930-143320952 AGATGCTCCGGCCGGGGGGCAGG + Intronic
1055090984 9:72364790-72364812 TGGTGCCGCCGCCGCGGGCCGGG + Intronic
1057933970 9:99221526-99221548 AGGTGAGGCGGCCGCGGGGCCGG - Exonic
1059942261 9:119369538-119369560 GGGAGCGGCGGCCGGGGGGCGGG + Intergenic
1062162397 9:135087623-135087645 GGGGGCCGCGGCCGGGAGGCGGG - Intronic
1062277145 9:135736494-135736516 GGGTGCCGGGGCTGGGGGGCTGG - Intronic
1062572974 9:137194094-137194116 GGGTGCCGGGGCCTGGGGTAGGG - Intronic
1062574551 9:137200190-137200212 GGGGGCCGCGGGCGGGGGCCGGG + Exonic
1062651189 9:137578646-137578668 AGCTGCGGCGGCCGGAGGACCGG - Exonic
1203783562 EBV:114778-114800 AGGGGCCTCGGCCTGGGGTAAGG - Intergenic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1189002873 X:36963964-36963986 GGGAGCCGCGGGCGGGGGCCTGG - Intergenic
1189322841 X:40096962-40096984 AGGGGGCGCGGCTGGGGGCCTGG - Intronic
1192125629 X:68498699-68498721 AGGTGCCGTGATCGAGGGTCTGG + Exonic
1192363870 X:70455267-70455289 AGGTGGGGCGGACGGGGGTCAGG + Intronic
1195853907 X:109310237-109310259 ATGTGCCCCAGCCGGGGGTAGGG + Intergenic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic
1200156924 X:153981765-153981787 AGCTCCTGAGGCCGGGGGTCAGG + Intronic