ID: 1020005746

View in Genome Browser
Species Human (GRCh38)
Location 7:4783099-4783121
Sequence GGGAGCTGCATCGCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020005746_1020005755 -2 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005755 7:4783120-4783142 CCAGGGAGAGAGGCTGGAGGCGG 0: 1
1: 0
2: 18
3: 179
4: 1254
1020005746_1020005752 -5 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005752 7:4783117-4783139 CTCCCAGGGAGAGAGGCTGGAGG 0: 1
1: 0
2: 11
3: 73
4: 602
1020005746_1020005762 25 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005762 7:4783147-4783169 GGCACCTTGTGGCCCGGGGTGGG 0: 1
1: 0
2: 2
3: 7
4: 174
1020005746_1020005761 24 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005761 7:4783146-4783168 AGGCACCTTGTGGCCCGGGGTGG 0: 1
1: 0
2: 1
3: 15
4: 212
1020005746_1020005760 21 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005760 7:4783143-4783165 AGCAGGCACCTTGTGGCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 146
1020005746_1020005756 4 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005756 7:4783126-4783148 AGAGAGGCTGGAGGCGGAGCAGG 0: 1
1: 0
2: 9
3: 94
4: 883
1020005746_1020005757 14 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005757 7:4783136-4783158 GAGGCGGAGCAGGCACCTTGTGG 0: 1
1: 0
2: 0
3: 14
4: 177
1020005746_1020005759 20 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005759 7:4783142-4783164 GAGCAGGCACCTTGTGGCCCGGG 0: 1
1: 0
2: 1
3: 26
4: 237
1020005746_1020005758 19 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005758 7:4783141-4783163 GGAGCAGGCACCTTGTGGCCCGG 0: 1
1: 0
2: 0
3: 32
4: 234
1020005746_1020005751 -8 Left 1020005746 7:4783099-4783121 CCAGCCTCAGCGATGCAGCTCCC 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1020005751 7:4783114-4783136 CAGCTCCCAGGGAGAGAGGCTGG 0: 1
1: 2
2: 11
3: 118
4: 841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020005746 Original CRISPR GGGAGCTGCATCGCTGAGGC TGG (reversed) Intronic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900761063 1:4470748-4470770 GGGAGCTGCATTGCTGATGTGGG + Intergenic
901395699 1:8979820-8979842 GGTAGCTGGAAGGCTGAGGCAGG - Intergenic
903950823 1:26994868-26994890 GGGTGCTGCATCCGTGCGGCAGG - Intronic
904788618 1:33000935-33000957 CAGAGCTGCATCTCTGATGCAGG - Intergenic
910935086 1:92480818-92480840 GGGAGCTGCAGCGCAGGGGCCGG - Exonic
912549435 1:110475503-110475525 GGAAGCTGCAGAGATGAGGCTGG + Intergenic
1067203443 10:44194327-44194349 GGGAGCTGCAGCCCTGTGGGTGG - Intergenic
1069839625 10:71331281-71331303 GGGAGCAGCATCGTGGAGGATGG + Intronic
1070811428 10:79300094-79300116 AGGAGCTGCAACGCTCAGGCAGG + Intronic
1073447607 10:103590767-103590789 GGCAGCTGCAGCCCTGAGCCAGG + Exonic
1075016685 10:118914799-118914821 AGGAGCAGCATAGCAGAGGCGGG - Intergenic
1075278051 10:121113023-121113045 GGGCGCAGCAAAGCTGAGGCTGG + Intergenic
1075940703 10:126388249-126388271 CGGAGCTGACTCGCCGAGGCAGG - Exonic
1076318293 10:129558890-129558912 GGAAGCTGCATCCCCGACGCCGG + Intronic
1081182808 11:40005126-40005148 GGGAGGTGCATTGCAGAGGCAGG + Intergenic
1081517952 11:43851880-43851902 GGGAACTGCATAGCTCAGGATGG - Intronic
1081672942 11:44951590-44951612 GACAGCAGCATCTCTGAGGCTGG - Intergenic
1082838352 11:57668103-57668125 GCGCGCTGCTTCTCTGAGGCAGG + Exonic
1085109661 11:73876552-73876574 GGCAGCTGGATCGTGGAGGCTGG + Intronic
1085721966 11:78920452-78920474 AGCAGCTGCACCGCTGAGCCCGG + Intronic
1086142894 11:83518489-83518511 GGGTGAGGCATCGCTGAAGCAGG - Intronic
1087212131 11:95455298-95455320 GGGAGCTGGGTCTCTGAGGGTGG + Intergenic
1089678716 11:120107735-120107757 GGGGGCTGGATGGCTGAGGCAGG - Intergenic
1092291372 12:7161298-7161320 GGAAGCTGCATCTCCGAGACAGG - Intergenic
1092587116 12:9911006-9911028 GTGTGCTGCATGGCTGATGCAGG - Intronic
1092860734 12:12717285-12717307 GGGAGCCGCCCCGCCGAGGCTGG - Exonic
1093228517 12:16514590-16514612 GACAGCTGCTTCTCTGAGGCAGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096154974 12:49336684-49336706 GGGAGCGGCACCGCCGCGGCTGG - Exonic
1096573989 12:52541255-52541277 CGGGGCTGCATGGCTGGGGCCGG - Intergenic
1101366218 12:104073192-104073214 TCTAGCTGCATCGCCGAGGCTGG + Intronic
1103076152 12:117984301-117984323 GGGAGCTGCAGGGCAGATGCAGG - Intergenic
1103164938 12:118762448-118762470 TGGAGTTGCAGCACTGAGGCTGG + Intergenic
1103739032 12:123078810-123078832 GGCAGCTGCAGCAGTGAGGCTGG - Intronic
1103972968 12:124683547-124683569 GGCAGCTGCCTGGCGGAGGCTGG - Intergenic
1104656004 12:130574549-130574571 TGGAGATGCATCGCTGAACCTGG + Intronic
1106100041 13:26686683-26686705 GGGAGCTACACCGCTGAGCTGGG + Exonic
1107654925 13:42582096-42582118 GGGAGTTGCAACACAGAGGCTGG - Intronic
1109545624 13:63837898-63837920 AGGAGCCCCATCGCAGAGGCGGG + Intergenic
1111197729 13:84895757-84895779 GGCAGGAGAATCGCTGAGGCAGG - Intergenic
1113448449 13:110388260-110388282 GGCAGCTGCCTGGCTGCGGCTGG - Intronic
1117898540 14:60510842-60510864 GGGAGCTGCGGCGCTGAGAAAGG + Intronic
1117942316 14:60981293-60981315 GGGAGCTTCAACGCTGAGCGGGG + Exonic
1119372783 14:74161879-74161901 GGAGGCTGCAAAGCTGAGGCAGG - Intronic
1123467601 15:20528288-20528310 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1123650513 15:22472754-22472776 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123716883 15:23040056-23040078 GACAGCTGCTTCGCTGATGCTGG - Intergenic
1123740921 15:23281596-23281618 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123746077 15:23320962-23320984 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124278346 15:28344279-28344301 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1127365418 15:58284765-58284787 GAGAGCCACATCGGTGAGGCTGG + Intronic
1128213272 15:65916875-65916897 GCGAGCTGCAGCGCCGAGGACGG - Exonic
1129845291 15:78765320-78765342 GGCAGCAGCTTCCCTGAGGCTGG - Intronic
1130236896 15:82143944-82143966 CCCAGCTGCATGGCTGAGGCAGG - Intronic
1130941599 15:88514278-88514300 GGAGGCTGAATGGCTGAGGCAGG + Intronic
1131262616 15:90895542-90895564 GAAAGCGGCATCGGTGAGGCTGG + Exonic
1131470060 15:92689003-92689025 GGGGGCTCCACCCCTGAGGCAGG - Intronic
1131574448 15:93572552-93572574 GGGAGCTCCTTGTCTGAGGCAGG + Intergenic
1131764975 15:95665779-95665801 GGGAGGTGGAGAGCTGAGGCAGG + Intergenic
1132009673 15:98265338-98265360 GGGAGCTCCTTCCCTGAGGTGGG - Intergenic
1132660790 16:1060654-1060676 GTCAGCTGCATGGCTGAGGGTGG + Intergenic
1132756480 16:1487764-1487786 GGAAGCTGCAGCGCCGAGGCCGG - Exonic
1132858384 16:2057767-2057789 GAGAGATGCAGGGCTGAGGCAGG - Intronic
1132858484 16:2058088-2058110 GAGAGATGCAGGGCTGAGGCAGG - Intronic
1132947250 16:2538296-2538318 GGGCGCTGCTTGGCTGCGGCGGG + Intronic
1132968465 16:2673160-2673182 GGGCGCTGCTTGGCTGCGGCGGG - Intergenic
1133762928 16:8814219-8814241 GGTGGGTGGATCGCTGAGGCAGG - Intronic
1135325152 16:21520985-21521007 GGGGGCTGCATCAATGTGGCTGG + Intergenic
1136336636 16:29614253-29614275 GGGGGCTGCATCAATGTGGCTGG + Intergenic
1136925765 16:34372462-34372484 GAGAGCAGCATGACTGAGGCAGG - Intergenic
1136978809 16:35039344-35039366 GAGAGCAGCATGACTGAGGCAGG + Intergenic
1137041889 16:35620773-35620795 TGGATCCGCATCGCTAAGGCTGG + Intergenic
1137480384 16:48847690-48847712 GGGAGGAGCATGACTGAGGCAGG - Intergenic
1139334692 16:66223579-66223601 GGGAGCTGGATGGCAGGGGCAGG - Intergenic
1139443952 16:66985229-66985251 AGGAGCTGCATAGCTGAGTGGGG + Intergenic
1139466986 16:67159440-67159462 GGGAGCTGCGTAGCTGAGTAGGG - Intronic
1142037362 16:87870037-87870059 GGGGGCTGCATCAGTGGGGCTGG + Intergenic
1142767877 17:2075860-2075882 TGGAGCTGCAGCGCCCAGGCAGG - Intronic
1143240433 17:5439002-5439024 GGGCGCGGCAGCGCGGAGGCCGG + Exonic
1144489965 17:15700102-15700124 GGGGACAGCATCCCTGAGGCTGG - Exonic
1144910996 17:18681857-18681879 GGGGACAGCATCCCTGAGGCTGG + Intronic
1145249654 17:21290133-21290155 GGGGGCTGCCTCACTGGGGCAGG + Intronic
1146184376 17:30715446-30715468 GGCAGCTGCATCGAGGAAGCGGG - Intergenic
1148147058 17:45372695-45372717 GGGAGCTGGAGCCCTGAGTCTGG - Intergenic
1151246656 17:72800168-72800190 AGGACCTCCATCCCTGAGGCAGG + Intronic
1151599255 17:75096291-75096313 CAGAGCTGCATAGCTGAGGGTGG - Intronic
1151601661 17:75109813-75109835 GCGAGCGGCTTCGCTGAGGCAGG - Intergenic
1151815673 17:76470334-76470356 GGAAGCGGCATCCATGAGGCTGG - Intergenic
1152724884 17:81940266-81940288 GGGAGCTGCCTCTCTGAACCAGG + Exonic
1154348574 18:13564683-13564705 GGGGGCGGCAGCGCAGAGGCGGG - Intronic
1157469773 18:47980040-47980062 GGGCCCTGCATCCCTGAGGGAGG - Intergenic
1158725183 18:59964788-59964810 GAGAGCTGCATTGCTGAGAAGGG - Intergenic
1160787360 19:907296-907318 TGAAGCTGCCTCCCTGAGGCCGG + Intronic
1160928792 19:1560052-1560074 CTGAGCTGCCTCCCTGAGGCTGG + Intronic
1161513326 19:4683437-4683459 GGGAGGGGCGTGGCTGAGGCCGG + Intronic
1162285466 19:9735662-9735684 GGGAGCTCCATGGGTGAGGGCGG + Intergenic
1162974401 19:14200228-14200250 GGCAGCTGCATCGAGGAAGCGGG + Intronic
1163526428 19:17824442-17824464 GGGACCAGCATCACTGGGGCCGG - Intergenic
1165039689 19:33060238-33060260 GGCAGCAGGATCGCTGAGCCTGG - Intronic
1165256470 19:34579570-34579592 GGGAGCTGCAAGGCTGAGCCAGG + Intergenic
1165266103 19:34664767-34664789 GGGAGCTGCAAGGCTGAGCCAGG - Intronic
1165273733 19:34731820-34731842 GGGAGCTTCAAGGCTGAGCCAGG - Intergenic
1165910619 19:39224415-39224437 GGGAGGGGGATGGCTGAGGCAGG - Intergenic
1166084497 19:40466020-40466042 GGGAGGTGGAGCGCGGAGGCAGG - Intergenic
1167428381 19:49441308-49441330 GGAAGCTGCACCGGTGAGCCTGG - Exonic
1167723984 19:51198843-51198865 AGCAGCAGCATCGCTGAGGCGGG - Intergenic
1167769389 19:51504989-51505011 GGGAGCAGAATCCCTGAAGCCGG - Intergenic
1168339800 19:55616405-55616427 AGGCGCTGCAGCGCTGGGGCCGG - Exonic
925298163 2:2791928-2791950 GTGACCAGCCTCGCTGAGGCTGG + Intergenic
925447858 2:3943088-3943110 GGCAGCTCCAGTGCTGAGGCGGG - Intergenic
925652374 2:6104642-6104664 GGGAACTGGATCGCTGCTGCAGG - Intergenic
927499614 2:23573991-23574013 GGGAGCTGCTTCCCTGAGCTTGG - Intronic
929420541 2:41785541-41785563 GGGAGCTGCATCCCAGCAGCTGG + Intergenic
932463660 2:71899157-71899179 GGTGGCTTCATCGATGAGGCAGG + Intergenic
933997276 2:87679236-87679258 GGGAGCAGAATCGCTGATGAAGG + Intergenic
934940894 2:98501220-98501242 GGCAGGAGAATCGCTGAGGCAGG + Intronic
935169212 2:100597549-100597571 GCTACCTGCAACGCTGAGGCAGG - Intergenic
935591844 2:104852333-104852355 GGGGGCTGCCTGGCTGCGGCTGG + Intergenic
935811076 2:106797703-106797725 GGGCGCTGCAGCCCTCAGGCAGG + Intergenic
936296576 2:111271674-111271696 GGGAGCAGAATCGCTGATGAAGG - Intergenic
938601747 2:132849568-132849590 GTGACCTGCATCTCTGTGGCAGG - Intronic
943407794 2:187511055-187511077 AGGATCTGCATCGCTCAAGCTGG - Intronic
946163947 2:217852455-217852477 GGGAGCTGCAAAGCAAAGGCTGG + Intronic
948221358 2:236272250-236272272 AGGAGCTTCACCGCTGGGGCAGG - Intergenic
1172649241 20:36491420-36491442 GGGACCTGCATGGCTGAGAGGGG + Intronic
1173345217 20:42192912-42192934 GGCAGCTGCCTTCCTGAGGCAGG + Intronic
1173608456 20:44349013-44349035 TGGAGGTGCGTCCCTGAGGCAGG + Intronic
1173793007 20:45840479-45840501 GGGAGCTGCTGCGCAGTGGCGGG - Intronic
1174475079 20:50790770-50790792 GGGAGCAGCAGCTCTGAGCCCGG + Intergenic
1174774890 20:53334470-53334492 GGGGTCTGCATGGCTGAAGCAGG + Intronic
1175166301 20:57047107-57047129 GGGATCTGCATTCCTGAGGCTGG - Intergenic
1175754689 20:61522135-61522157 GGGAGCTGCCAAGCTGAAGCAGG - Intronic
1176004370 20:62852291-62852313 GGCCACTGCAACGCTGAGGCCGG + Intronic
1176185490 20:63776109-63776131 GGCTGCTGCATTGCTGGGGCAGG - Intronic
1179427159 21:41290615-41290637 AGGAGCTGCAACCCTGGGGCGGG - Intergenic
1179438403 21:41377448-41377470 GGGAGCTGCAGAGCTGGGGAGGG - Intronic
1180961123 22:19762839-19762861 GGGAGCTGCTTCGATCAAGCTGG + Intronic
1181015502 22:20066314-20066336 AGGAGCTTCATCCCTGAGCCTGG + Intergenic
1182775336 22:32827332-32827354 GACAGCTGCATAGCTCAGGCTGG + Intronic
1182777759 22:32843514-32843536 GGGAGCGGCCTTGCTGAGGCCGG - Intronic
1183094753 22:35545465-35545487 GGGGGCTGCATCCCAGAGGTGGG - Intronic
1184543532 22:45148078-45148100 GGGACTTGCAAGGCTGAGGCAGG - Intergenic
1185023543 22:48394765-48394787 GGATGCTGCCACGCTGAGGCCGG - Intergenic
1185062964 22:48616616-48616638 GGGAGTGGCCTCGCTGAGGCCGG + Intronic
950017962 3:9767625-9767647 GGGTGCTGGATGGCTGAGGGAGG - Intronic
950953189 3:17023236-17023258 GGGAATTGCAGCTCTGAGGCAGG - Intronic
951166609 3:19490102-19490124 AGGATCTGCATCGCTCAAGCTGG + Intronic
951913018 3:27770807-27770829 GAGAGTTGCATGGCTGAGGAGGG + Intergenic
951920789 3:27852371-27852393 GGGAGCTGACTCCCTGAGACAGG - Intergenic
952694361 3:36248581-36248603 GTGAGCGGCATTGCTGAGTCAGG + Intergenic
953469655 3:43155837-43155859 GTGAGGAGCATCTCTGAGGCAGG - Intergenic
953848631 3:46448837-46448859 GGGAGCTCCATCACAGGGGCGGG - Intronic
955345175 3:58155807-58155829 GGGAGTCGCCTGGCTGAGGCTGG - Intronic
961555268 3:127692741-127692763 GGGACCTCCATTGCTGTGGCAGG + Intronic
961563199 3:127745749-127745771 GGCAGCTGCATCCCAGAGGATGG - Intronic
962197131 3:133373872-133373894 GAGAGCTGCCTAGCTGAGCCTGG - Intronic
967840834 3:194003458-194003480 GGGAGCTGCAGGGCCGAGGCAGG - Intergenic
968903849 4:3442965-3442987 GGGAGGAGCATGGCTGCGGCTGG + Intronic
969621464 4:8280935-8280957 GGGAGCTGCAGGGCAGAGGTGGG + Intronic
969674554 4:8607700-8607722 AGGAACAGCAGCGCTGAGGCAGG - Intronic
969724549 4:8911479-8911501 GGGAGCTGCATCACCGAGTCAGG + Intergenic
971369330 4:26003243-26003265 GGGATCTGCTTCACAGAGGCTGG + Intergenic
977060959 4:92256461-92256483 GGGAGCTGCATGTCTGAGACTGG - Intergenic
977244743 4:94618105-94618127 GGCAGCTGCAGCTGTGAGGCTGG - Exonic
991439802 5:66634972-66634994 AGGACCTGCATCCCAGAGGCAGG - Intronic
997454048 5:134004686-134004708 GGGGGCTGCGACGCGGAGGCAGG + Intronic
997834989 5:137184915-137184937 AGGAGTGGCATCTCTGAGGCGGG - Intronic
1001683141 5:173573334-173573356 GGGAGCAGCAGCCCTGGGGCCGG + Intergenic
1002059263 5:176616803-176616825 TGGAGCTGCATTGCTGGGGGTGG + Intergenic
1003880669 6:10477048-10477070 GGCAGCTGCAATGCTGTGGCAGG - Intergenic
1004339830 6:14798506-14798528 TGGACCTGCATCCCTGAGGGAGG + Intergenic
1006669713 6:35722446-35722468 GGGAGCTTCAGGGCTGAGCCTGG - Intronic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1007363522 6:41374490-41374512 GGGAGCTGGAAAGCTCAGGCAGG - Intergenic
1010521339 6:76842007-76842029 GGGAGCTCCTACTCTGAGGCAGG - Intergenic
1016517454 6:144910674-144910696 ATGAGTTGCATGGCTGAGGCAGG + Intergenic
1018090750 6:160345754-160345776 GGGGACTGCATTGCTGAGGGAGG + Intergenic
1018582352 6:165317902-165317924 CGCAGCACCATCGCTGAGGCAGG - Intergenic
1019258067 7:64292-64314 GGGAGCTGCAGTGCAGGGGCAGG + Intergenic
1019605531 7:1908194-1908216 GGCAGCTGCAGCCCTGAGCCAGG - Intronic
1019984036 7:4642132-4642154 GGGAGCTGCCGCGCCGGGGCCGG - Intergenic
1020005746 7:4783099-4783121 GGGAGCTGCATCGCTGAGGCTGG - Intronic
1020139036 7:5602788-5602810 GGCAGGAGGATCGCTGAGGCAGG - Intronic
1022049113 7:26647918-26647940 GGGAGCTTCCTCACTGAGGGTGG - Intergenic
1022187008 7:27979696-27979718 GGGAGCTGCAGGGCAAAGGCAGG - Intronic
1022770644 7:33468802-33468824 TGCAGCAGCATAGCTGAGGCTGG - Intronic
1023598143 7:41854101-41854123 GGGAGCTGCAGCCCTAAGGACGG + Intergenic
1024974659 7:55102098-55102120 GGGACCTGCAGGGCAGAGGCAGG - Intronic
1026965029 7:74434071-74434093 GTGAGCGGCAGAGCTGAGGCTGG + Intergenic
1027048284 7:75005649-75005671 AGGAGCAGGATAGCTGAGGCTGG + Intronic
1027691737 7:81354873-81354895 AGGAGCTGCATCGCTACTGCAGG - Intergenic
1029384729 7:100236018-100236040 AGGAGCAGGATAGCTGAGGCTGG - Intronic
1030106260 7:105989883-105989905 GGGAGCTGAATGACTGGGGCAGG - Intronic
1032841955 7:135721436-135721458 GGGAGCTGCAGCCCTGGTGCCGG - Exonic
1033497162 7:141910629-141910651 GGGTTCTGCATTGCTGGGGCGGG + Intronic
1034426429 7:151016602-151016624 GGGAGCTGGGGCGCTGAGGGGGG - Intronic
1035663315 8:1363293-1363315 GGGACCTGCAAGGCAGAGGCAGG - Intergenic
1035754581 8:2022069-2022091 GTGAGGAGCATGGCTGAGGCTGG + Intergenic
1036489412 8:9211199-9211221 GGGAGATGAATGGCTCAGGCTGG + Intergenic
1036723946 8:11201781-11201803 GTGAGCTGCGACGCTGAGGAAGG - Intergenic
1037921478 8:22809337-22809359 GGGCTGTGCATGGCTGAGGCAGG + Intronic
1047206003 8:122803302-122803324 GGGAGTGGCACCTCTGAGGCGGG - Intronic
1047521734 8:125600288-125600310 GGGAGCTCCATGGCTGAGCTGGG + Intergenic
1048328150 8:133454221-133454243 GGCTGCTGCATGGCTGAGGGCGG - Intergenic
1048445695 8:134491268-134491290 GTGAGCAGCATCGCTGATGCCGG - Intronic
1048967559 8:139625434-139625456 GGGATCTGCACAGCTGAGTCAGG - Intronic
1049386546 8:142345636-142345658 GGGAGCTGCAGGGAGGAGGCTGG - Intronic
1053154916 9:35770814-35770836 GGGAGATGCTTAGCGGAGGCTGG - Intergenic
1056329525 9:85510234-85510256 GGGAGCTGCAGAGGTGAGGAGGG + Intergenic
1056569131 9:87800553-87800575 TGGGGCTGCATTCCTGAGGCAGG - Intergenic
1057441953 9:95089756-95089778 GGGAGCTGCTGAGCTGAGGCTGG - Intergenic
1060245448 9:121942106-121942128 GGGGGCTGAATGGCAGAGGCTGG - Intronic
1062028772 9:134352617-134352639 GGGAGCTGCAGGGCTCAGCCAGG - Intronic
1062287819 9:135780930-135780952 GAGAGGTGCAAGGCTGAGGCCGG - Intronic
1062409548 9:136416059-136416081 GGCTGCTTCATGGCTGAGGCGGG + Intronic
1187685694 X:21813624-21813646 GGGAGCTGCCTGGCAGAGGCTGG + Intergenic
1188849123 X:35110430-35110452 GGGGGCTGCATCCCTGTGGCAGG + Intergenic
1193069576 X:77294147-77294169 TGGGTCTGCATCGCTCAGGCTGG - Intergenic
1193391011 X:80929432-80929454 AGGGGCTGCAGCGCGGAGGCAGG - Intergenic
1198360477 X:135890315-135890337 AGGATCTGCATCGCTCAAGCTGG - Intronic
1199757745 X:150881083-150881105 GGGAGCTGCCTGGCTGTGGCTGG + Intronic
1200139353 X:153891016-153891038 GGGCTCTGCATGGCAGAGGCTGG - Intronic