ID: 1020005970

View in Genome Browser
Species Human (GRCh38)
Location 7:4783956-4783978
Sequence CCCCTGACCCGTGTGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020005954_1020005970 28 Left 1020005954 7:4783905-4783927 CCAGGACGAGCCTGCCTCTGCTG 0: 1
1: 0
2: 3
3: 21
4: 236
Right 1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG 0: 1
1: 1
2: 2
3: 28
4: 181
1020005958_1020005970 18 Left 1020005958 7:4783915-4783937 CCTGCCTCTGCTGCGGGGCTTGG 0: 1
1: 0
2: 2
3: 31
4: 330
Right 1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG 0: 1
1: 1
2: 2
3: 28
4: 181
1020005961_1020005970 14 Left 1020005961 7:4783919-4783941 CCTCTGCTGCGGGGCTTGGGTCA 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG 0: 1
1: 1
2: 2
3: 28
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020005970 Original CRISPR CCCCTGACCCGTGTGGCTCT GGG Intronic
900422332 1:2560996-2561018 CCCCTGTCCCCTGGGGCTGTGGG + Intronic
900607265 1:3529397-3529419 CCCCTGCCCCGTGTGGGGCTTGG - Intronic
900659805 1:3776785-3776807 CCCCCCTCCCATGTGGCTCTAGG + Intergenic
900872512 1:5314299-5314321 CACCTGACTCCTGTGGCTCAGGG + Intergenic
900989893 1:6093668-6093690 ACCCAGACCCCTGTGGCCCTGGG + Intronic
901022644 1:6262865-6262887 CCACTCATCCGTGTGGCTTTGGG - Intergenic
901105016 1:6748553-6748575 CCCCTGACACGTGGGGATCACGG - Intergenic
903448895 1:23439372-23439394 CCCCTGACCCCTGACTCTCTGGG + Intronic
903679860 1:25089510-25089532 CCTCTGTCCTGTGTGGATCTGGG - Intergenic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
907659040 1:56374935-56374957 CCACTGATCTGTGTGGCTTTGGG - Intergenic
912959217 1:114180659-114180681 CCCCTGACCCCTGGGCCCCTCGG + Intergenic
913356516 1:117929053-117929075 CCCCTCACCCGAGGTGCTCTCGG + Intronic
914400529 1:147316238-147316260 CCCCTGCTCCATGTGGCTCTTGG - Intergenic
915510482 1:156384442-156384464 CCCCTGTGCCCTGTGGCACTGGG + Intronic
915660837 1:157403695-157403717 CCCCTCAGCAGTGAGGCTCTGGG + Intergenic
915908619 1:159898575-159898597 CCCCTGCCCTGAGTGGCTCCTGG + Intronic
918098972 1:181357182-181357204 CCCCAGACCAGTGAGCCTCTGGG - Intergenic
919661721 1:200254232-200254254 CCCCTTCCCTCTGTGGCTCTGGG - Intergenic
920387388 1:205578624-205578646 CCCCTGACCCCCTTGGCTCTTGG - Intronic
920872638 1:209806619-209806641 CCTCTTACCCGTGTGACCCTGGG + Intergenic
921010386 1:211134495-211134517 CCCGGGACCTGTGAGGCTCTGGG + Intergenic
924415345 1:243850864-243850886 CCCCTCGCCCGCGTGGCCCTTGG + Intronic
924638347 1:245809759-245809781 TCCCTGAGCAGTGTGGCCCTGGG - Intronic
1062947438 10:1472315-1472337 CCCCTGAGCCGCATGGCCCTTGG - Intronic
1063139282 10:3242177-3242199 CCCTTGACGAGGGTGGCTCTGGG - Intergenic
1063230638 10:4062963-4062985 CCCCTGACCTGTGTGGCCAATGG + Intergenic
1065972707 10:30818101-30818123 CCACTGGCCCGTGTAGCCCTTGG + Intergenic
1066244844 10:33572286-33572308 CCCCTGATCCTTGTAGCTCAAGG - Intergenic
1067519281 10:46983790-46983812 CCCCTGGCCCCTGCTGCTCTGGG + Intronic
1069081427 10:64092411-64092433 CATCTGACCAGTGTGGCTTTCGG + Intergenic
1070288449 10:75099993-75100015 CTCCAGACCAGTGTGGCTGTTGG - Intronic
1070383738 10:75904825-75904847 CTCGTGACCTGTGTGGCTCGGGG + Intronic
1073139214 10:101236630-101236652 CCCCTGACCCATGGGGCCCGAGG - Intergenic
1075741874 10:124701030-124701052 GCCCTGACTCCTGAGGCTCTGGG + Intronic
1076673907 10:132137830-132137852 CACCTGCCCCGTGTGGCCCCTGG + Intronic
1076843907 10:133059795-133059817 CCCCAGACCCGTGTCCCTCAGGG - Intergenic
1077323277 11:1952006-1952028 TCCCTGCCCCCTGTGGGTCTTGG + Intronic
1081570896 11:44290117-44290139 CCCCTAAACCATGTGGCCCTGGG + Intronic
1083949419 11:65945856-65945878 TCCCTGACCCACCTGGCTCTAGG - Intronic
1084327030 11:68406417-68406439 CCCCTGAGCTGTGTGGCTCACGG + Intronic
1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG + Intronic
1088037349 11:105333987-105334009 CCCTTACCCCGTGTGGCTCCTGG - Intergenic
1090035292 11:123244665-123244687 CCCATGAAACGTGTAGCTCTTGG - Intergenic
1090307010 11:125699847-125699869 CCCCTGACCCCTCTGCCTCCTGG - Intergenic
1202806265 11_KI270721v1_random:7201-7223 TCCCTGCCCCCTGTGGGTCTTGG + Intergenic
1091604103 12:1935780-1935802 CACCTGACCCGTGAGGCTGATGG + Intergenic
1092304429 12:7284232-7284254 TCCCTGACCCCTGTGCCTCCTGG + Intergenic
1098352174 12:69574371-69574393 CTCCTGACCCCTGAGGCACTAGG - Exonic
1099236040 12:80083734-80083756 TCCCTGACCCCTGTGCCTCCTGG - Intergenic
1101969585 12:109303642-109303664 CCACTGAGCCTTGTGGCCCTGGG + Intronic
1103700790 12:122847804-122847826 CCCCTGACTCCTGGAGCTCTTGG + Intronic
1104761431 12:131299482-131299504 CCCCTTCCGCGTCTGGCTCTGGG + Intergenic
1104818345 12:131661310-131661332 CCCCTTCCGCGTCTGGCTCTGGG - Intergenic
1107840452 13:44451812-44451834 CCCCTTACCTGTGGGGCTGTTGG + Intronic
1110567239 13:76968530-76968552 CCCCTGACCCACGTGGCTCTCGG + Intergenic
1110826275 13:79975111-79975133 CCCCTGACCCTTGTGCTTCCTGG - Intergenic
1113786511 13:113004663-113004685 TCCCTGAGCTGTGTGACTCTGGG - Intronic
1116419133 14:44712963-44712985 CCCCTGACTGATGTTGCTCTTGG - Intergenic
1117786448 14:59290970-59290992 CCCCTGACCTTTGTGACTGTAGG + Intronic
1122599657 14:102914963-102914985 TCCCTGGCCCCTGTGGCACTTGG + Intergenic
1124655352 15:31502806-31502828 CCCCTTCCCTGTGTGGCTCAGGG - Intronic
1128250302 15:66159359-66159381 TCCCTGACCTCTGTGGCTCCTGG - Intronic
1129112175 15:73343812-73343834 CGACTGACCCCTGTGTCTCTGGG - Intronic
1129772516 15:78211845-78211867 CCTCTCACCCCTGTGGCCCTTGG + Intronic
1130934686 15:88458940-88458962 CCCCTCACCTCTGGGGCTCTTGG - Intergenic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1132700389 16:1219780-1219802 CTCCTGACCTGTGAGGCTCCCGG - Intronic
1133405562 16:5521582-5521604 CACCTGTCCCCTGTGACTCTGGG - Intergenic
1133433974 16:5763473-5763495 CCCCTGGCCCAGGAGGCTCTTGG + Intergenic
1135106391 16:19653539-19653561 CCCCTGATCTGTCTGGCTCAAGG + Intronic
1137033580 16:35547702-35547724 CCACAGACCCGTTTGGCTCCAGG + Intergenic
1137773320 16:51035868-51035890 CCCCTGATCTGTGCAGCTCTGGG - Intergenic
1138092526 16:54187881-54187903 CCTCTTCCCCATGTGGCTCTAGG - Intergenic
1139483108 16:67241485-67241507 TCCCTGACGGGGGTGGCTCTGGG - Intronic
1140953164 16:79838410-79838432 CCCCTGCCCTGTGTTGCTCTGGG - Intergenic
1141275511 16:82584295-82584317 CCCCTGCCCTGTGAGCCTCTTGG + Intergenic
1141998974 16:87653183-87653205 CCTCTGAACAGTGTGGCTCTGGG + Intronic
1142215759 16:88829048-88829070 CTCGGGACCCGTGTAGCTCTGGG - Intronic
1142388086 16:89779683-89779705 AACCTGCCCCATGTGGCTCTGGG + Intronic
1142562549 17:819402-819424 CCCCGGCTCCGTGTGGCTCCTGG - Intronic
1143022996 17:3926274-3926296 CCCCCGCCCCGTCTGGCTTTAGG + Intronic
1144621985 17:16823748-16823770 CCCCTGACCCTTGGGGCTTCAGG - Intergenic
1144884439 17:18448966-18448988 CCCCTGACCCTTGGGGCTTCAGG + Intergenic
1145147790 17:20495411-20495433 CCCCTGACCCTTGGGGCTTCAGG - Intergenic
1146160169 17:30555328-30555350 TCCCTGACCCGGATGGCTCCAGG + Intergenic
1146668144 17:34718402-34718424 CCCCTGGCCTGTGGGGATCTGGG - Intergenic
1147573956 17:41588082-41588104 CCCCTGACCCTTGGGGCTTCAGG - Intergenic
1148152681 17:45405583-45405605 CCCCTCACCCGTGTGTCCCTGGG + Intronic
1148185131 17:45637494-45637516 CCACTGGCCTGTGGGGCTCTGGG - Intergenic
1151361248 17:73590466-73590488 GCTCTGCCCCGTCTGGCTCTGGG + Intronic
1152491434 17:80637250-80637272 CCCATGCCCAGCGTGGCTCTGGG + Intronic
1154391332 18:13938923-13938945 CTGCTGCCCAGTGTGGCTCTGGG - Intergenic
1157625855 18:49050568-49050590 CCGCAGCCCCGTGTGGCTCAGGG - Intronic
1157896250 18:51471028-51471050 CCCATGACCCCTCTGGCCCTGGG + Intergenic
1160474502 18:79170218-79170240 CCCAGGCCCAGTGTGGCTCTGGG - Intronic
1160521476 18:79510762-79510784 TCCCTGCCCTGTGTGGCCCTGGG + Intronic
1160686892 19:441043-441065 CCTCTGTCCCTGGTGGCTCTGGG + Intronic
1162042448 19:7979014-7979036 CCCCTGGCCAGTGTGGTGCTGGG - Intronic
1162321488 19:9973504-9973526 CCCCTGACCCCTGGGCATCTTGG - Intronic
1165062038 19:33209539-33209561 CCCCCGACCCCTGGGGGTCTGGG + Intronic
1166290295 19:41859497-41859519 CCGCTGACCTGTGTAGCTTTAGG - Intergenic
1166391289 19:42410278-42410300 CCCCTGCCCCGTGCCCCTCTGGG - Intronic
1167724431 19:51200828-51200850 CCCCTGGCTCCTGTGGCTCCTGG + Intergenic
1167758323 19:51427025-51427047 CCCCTGGCTCCTGTGGCTCCTGG - Intergenic
927110013 2:19857962-19857984 CACCTGTCGCGTGTGGCCCTGGG - Intergenic
927221192 2:20711594-20711616 CCCCTGACCCTTGTGTTTCTGGG - Intronic
927364943 2:22283804-22283826 CACCTGACTCCTGTGGCTGTCGG + Intergenic
927699070 2:25256558-25256580 CCCCAGCCACATGTGGCTCTTGG - Intronic
931231069 2:60375365-60375387 CCCCTGACCCCTGTGGTTGGGGG + Intergenic
932655642 2:73609060-73609082 ACCCTGCCCCGTGAGGTTCTTGG - Intronic
933489712 2:82970219-82970241 TCCCAGACCCGTGTTGCTCCAGG - Intergenic
935206874 2:100903819-100903841 CCCCAGACAGGTGGGGCTCTGGG + Intronic
936239233 2:110772671-110772693 CCCCTCACTCGTGTGGATCATGG - Intronic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
947875384 2:233464353-233464375 CTTGTGACCCGTGTGGCTCTGGG + Intronic
948143420 2:235691173-235691195 CCCCAGCCCCGAGAGGCTCTGGG + Intronic
948163727 2:235845163-235845185 TCCTTGACATGTGTGGCTCTTGG - Intronic
948808443 2:240462946-240462968 CCCCTGGCCTGCGAGGCTCTGGG - Intronic
949043118 2:241858525-241858547 ACCCTGAGCTGTGTGGCTTTGGG - Intronic
1169426654 20:5502274-5502296 CCCCTGCCACATGTGCCTCTTGG + Intergenic
1172525754 20:35599949-35599971 CCACTGACCCTTGCTGCTCTGGG - Intergenic
1175468176 20:59207152-59207174 GGCCTGACCCCTGTGGCACTTGG - Intronic
1175889112 20:62308299-62308321 CAGCTGAGCAGTGTGGCTCTGGG + Intronic
1176029214 20:63003221-63003243 CCCGTGACCAGTGTTGCTGTAGG - Intergenic
1176114263 20:63424281-63424303 CCCCTGACCCATGGGACTGTGGG - Intronic
1176298415 21:5086619-5086641 CCCCTGCCCCATCTGGTTCTGGG - Intergenic
1178327421 21:31657203-31657225 CCCCTGCTCCTTGTGGCACTGGG + Intergenic
1179858611 21:44175330-44175352 CCCCTGCCCCATCTGGTTCTGGG + Intergenic
1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1179883397 21:44302816-44302838 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1182149888 22:28020467-28020489 CCCCTGACCCCTCTGCCCCTTGG - Intronic
1183083629 22:35473160-35473182 CACCTGACCTGTCTGGATCTTGG - Intergenic
1183389687 22:37538492-37538514 CCCCTGAGGCCTGTGGGTCTTGG - Intergenic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
950121008 3:10482609-10482631 TCCCTGACCTGTGTGTCCCTGGG + Intronic
950995864 3:17495019-17495041 CCCTTGCCCCGTGCGGCTCCCGG + Intronic
953947998 3:47164853-47164875 CCCCTCTCCTGTGTGGTTCTTGG + Intergenic
954615672 3:51967683-51967705 CCCCCAACCCGTGGGGCTCTGGG - Intronic
955363540 3:58293049-58293071 CCCATGGTCCGTGTGGCTGTAGG + Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
959479422 3:106853565-106853587 TCCCTGACCCCTGTGCCTCTTGG + Intergenic
960017005 3:112902614-112902636 TCCCTCCCCCATGTGGCTCTCGG + Intergenic
960949840 3:122992248-122992270 CCCCTGACCCGTGGGCTGCTGGG - Intronic
962369066 3:134805683-134805705 CATCTGTCCCGTGTGCCTCTGGG + Intronic
966809147 3:183827969-183827991 TCCCTGGCCCGTGGGCCTCTTGG - Intergenic
970164902 4:13226399-13226421 CCCTTGCCCCATGTGGCTCCTGG - Intergenic
970344560 4:15141007-15141029 GACATGAGCCGTGTGGCTCTGGG - Intergenic
977561271 4:98536459-98536481 TCCCTGACCCCTGTGTATCTGGG - Intronic
980310903 4:131127726-131127748 GCCCTCACCCCCGTGGCTCTAGG - Intergenic
982528127 4:156505505-156505527 TTCCTGCCCCGTGTGGCTCTCGG - Intergenic
985803679 5:2022634-2022656 CCACTGACCTGTGTGGCTTTGGG - Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
988167780 5:27616752-27616774 CCCCTGACCCCAGTGCCTCCAGG - Intergenic
990620205 5:57550657-57550679 CCCCTGCCCTGTGTGGCTCTCGG + Intergenic
991405009 5:66293252-66293274 CCCCCCACCCATGTGGCTCCAGG + Intergenic
996005775 5:118419550-118419572 CCCTTGAGCCATGTGGCTCCTGG - Intergenic
997697281 5:135871684-135871706 CCCCTGTGCCGTGTGGCTGGCGG + Intronic
998157154 5:139793511-139793533 CCCCTGTCCTTTGTAGCTCTGGG - Intergenic
998462790 5:142321940-142321962 CCCTTGAGCTGTGTTGCTCTGGG - Intronic
999192615 5:149759798-149759820 CCCCTGGCCCAGGGGGCTCTTGG - Intronic
1001288883 5:170442558-170442580 GCCCTGCCCTGTCTGGCTCTGGG + Intronic
1001734550 5:173988350-173988372 CCCCCTACCCCTGTGTCTCTTGG + Intronic
1002181452 5:177433089-177433111 CCCCTGACACCTCAGGCTCTTGG - Intronic
1003618219 6:7674154-7674176 TCCCTTCCCTGTGTGGCTCTGGG + Intergenic
1006964082 6:37964337-37964359 CTTCTGACCTGTGTGGCTCTTGG + Intronic
1007260112 6:40557454-40557476 CCCCTGACCACTGTGCCTGTAGG - Intronic
1009994094 6:70879978-70880000 TCCCTGACCCGTTAGGCTCCAGG - Intronic
1011101543 6:83728040-83728062 CCCCTGACCTCTGTGTCTCTGGG + Intergenic
1012314984 6:97774780-97774802 CCCCTTACCTGTGTGGCTTCCGG - Intergenic
1018092672 6:160358638-160358660 CCCCCCATCCGGGTGGCTCTGGG + Intronic
1018465003 6:164035824-164035846 ACCCTGACCACTGTGGCTCTGGG - Intergenic
1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG + Intronic
1020766660 7:12330425-12330447 CCACTTACCTGTGTGGTTCTGGG + Intergenic
1021092205 7:16496829-16496851 CCCATGACCTGTGGGGCTCATGG + Intronic
1021776439 7:24059457-24059479 CCCTTGCCCCATGTGGCTCCCGG - Intergenic
1022805333 7:33815527-33815549 CCACTGTCCCGTGAGGCTCTAGG - Intergenic
1032262480 7:130348137-130348159 CCTCCCACCCGTGTGGCTTTAGG - Intronic
1034424606 7:151007876-151007898 GCCCTGAACAGTGTGGCACTGGG - Intronic
1035599641 8:890005-890027 CCCCTTCCCCGTGTGTTTCTCGG + Intergenic
1035637633 8:1158720-1158742 ACCAGGACCCGCGTGGCTCTGGG - Intergenic
1036724207 8:11204943-11204965 CCCCTTACCCATGTGACTCTGGG - Intergenic
1036806891 8:11841259-11841281 CCTCTGACCCATGTGAATCTAGG + Intergenic
1042024271 8:64405835-64405857 CCCCTGACCCCTGTGCTTCCTGG + Intergenic
1042532838 8:69832882-69832904 CCCCTGCCCCCTGTGGCACGCGG - Exonic
1042666178 8:71209093-71209115 CCTCTGACCAGTATGGCCCTAGG - Intronic
1046811653 8:118539594-118539616 CCCCAGGACCCTGTGGCTCTGGG - Intronic
1048367947 8:133754763-133754785 CCCCTGAGCTGTGTGACTTTTGG + Intergenic
1049106157 8:140614646-140614668 ACCTTGACTCGTGTGGCTCCTGG - Intronic
1049305268 8:141899503-141899525 CCCCTGCCCTGGGTGGCTCAGGG + Intergenic
1049544147 8:143221715-143221737 CCCCTGCCCCAGGTGGCTCCGGG - Intergenic
1050262336 9:3853658-3853680 ACCCTGAACTGTGTGACTCTGGG - Intronic
1051530459 9:18096454-18096476 CCACTGGCCCATGTGGCTCTTGG + Intergenic
1052352498 9:27471437-27471459 CCCCTGCGCTTTGTGGCTCTTGG + Intronic
1052917070 9:33931534-33931556 CCCCTGCCCTCTGTGGCTCATGG - Intronic
1057428175 9:94971092-94971114 CCCCTGAGCCCTCTGGCTCTGGG + Intronic
1058707656 9:107650528-107650550 CACCTCTCCAGTGTGGCTCTTGG + Intergenic
1059726803 9:117016323-117016345 GCCCTGACACCTGTGGCTCTTGG - Intronic
1061946588 9:133911871-133911893 ATCCTGACCTGTGGGGCTCTGGG - Intronic
1062030250 9:134358925-134358947 CCCCTGCCACGTGGGGCTGTTGG - Intronic
1187393787 X:18903366-18903388 CCCCAGTCCCGTGTGACTCTCGG + Intronic
1187419326 X:19121763-19121785 CCCCTGCTTCGTCTGGCTCTCGG + Intronic
1191255527 X:58278007-58278029 CGCCTGACCCAGGTGGGTCTTGG - Intergenic
1191974561 X:66858118-66858140 TCCCTGACCCCTGTGCCTCCTGG + Intergenic
1192064219 X:67864199-67864221 CCCCTGACCCCTGTGCCTCCTGG - Intergenic
1194286697 X:92019952-92019974 CCCCTGCCTCATGTGGCTCTTGG - Intronic
1194330767 X:92580871-92580893 CCCTTGCCCCGTGTGGCTCCTGG + Intronic
1195376616 X:104234185-104234207 CCCCTGCCTCTTCTGGCTCTTGG - Intergenic
1199783013 X:151080787-151080809 CTCCCTACCCTTGTGGCTCTGGG - Intergenic
1200604243 Y:5244512-5244534 CCCCTGCCTCATGTGGCTCTTGG - Intronic
1200639471 Y:5699941-5699963 CCCTTGCCCCGTGTGGCTCCTGG + Intronic
1200812813 Y:7502688-7502710 CTTCTGACCCCTCTGGCTCTAGG - Intergenic