ID: 1020007031

View in Genome Browser
Species Human (GRCh38)
Location 7:4788595-4788617
Sequence GGAGGCCTGTGGCCGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007031_1020007045 26 Left 1020007031 7:4788595-4788617 CCTGGGACCGGCCACAGGCCTCC 0: 1
1: 0
2: 1
3: 20
4: 276
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007031_1020007043 25 Left 1020007031 7:4788595-4788617 CCTGGGACCGGCCACAGGCCTCC 0: 1
1: 0
2: 1
3: 20
4: 276
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007031_1020007040 11 Left 1020007031 7:4788595-4788617 CCTGGGACCGGCCACAGGCCTCC 0: 1
1: 0
2: 1
3: 20
4: 276
Right 1020007040 7:4788629-4788651 CACGCCAGCCTTTGTCCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007031 Original CRISPR GGAGGCCTGTGGCCGGTCCC AGG (reversed) Intronic