ID: 1020007032

View in Genome Browser
Species Human (GRCh38)
Location 7:4788602-4788624
Sequence GAGGGCAGGAGGCCTGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 738}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007032_1020007045 19 Left 1020007032 7:4788602-4788624 CCGGCCACAGGCCTCCTGCCCTC 0: 1
1: 0
2: 5
3: 78
4: 738
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007032_1020007040 4 Left 1020007032 7:4788602-4788624 CCGGCCACAGGCCTCCTGCCCTC 0: 1
1: 0
2: 5
3: 78
4: 738
Right 1020007040 7:4788629-4788651 CACGCCAGCCTTTGTCCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 83
1020007032_1020007043 18 Left 1020007032 7:4788602-4788624 CCGGCCACAGGCCTCCTGCCCTC 0: 1
1: 0
2: 5
3: 78
4: 738
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007032 Original CRISPR GAGGGCAGGAGGCCTGTGGC CGG (reversed) Intronic