ID: 1020007033

View in Genome Browser
Species Human (GRCh38)
Location 7:4788606-4788628
Sequence GGCTGAGGGCAGGAGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 1, 1: 4, 2: 10, 3: 123, 4: 1055}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007033_1020007045 15 Left 1020007033 7:4788606-4788628 CCACAGGCCTCCTGCCCTCAGCC 0: 1
1: 4
2: 10
3: 123
4: 1055
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007033_1020007047 30 Left 1020007033 7:4788606-4788628 CCACAGGCCTCCTGCCCTCAGCC 0: 1
1: 4
2: 10
3: 123
4: 1055
Right 1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 81
1020007033_1020007040 0 Left 1020007033 7:4788606-4788628 CCACAGGCCTCCTGCCCTCAGCC 0: 1
1: 4
2: 10
3: 123
4: 1055
Right 1020007040 7:4788629-4788651 CACGCCAGCCTTTGTCCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 83
1020007033_1020007043 14 Left 1020007033 7:4788606-4788628 CCACAGGCCTCCTGCCCTCAGCC 0: 1
1: 4
2: 10
3: 123
4: 1055
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007033 Original CRISPR GGCTGAGGGCAGGAGGCCTG TGG (reversed) Intronic