ID: 1020007034

View in Genome Browser
Species Human (GRCh38)
Location 7:4788613-4788635
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1877
Summary {0: 1, 1: 0, 2: 8, 3: 140, 4: 1728}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007034_1020007050 25 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007050 7:4788661-4788683 CCCGGGTGTGCTGACGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 125
1020007034_1020007045 8 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007034_1020007048 24 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007048 7:4788660-4788682 TCCCGGGTGTGCTGACGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1020007034_1020007043 7 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007034_1020007040 -7 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007040 7:4788629-4788651 CACGCCAGCCTTTGTCCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 83
1020007034_1020007047 23 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007034 Original CRISPR TGGCGTGGGCTGAGGGCAGG AGG (reversed) Intronic