ID: 1020007035

View in Genome Browser
Species Human (GRCh38)
Location 7:4788616-4788638
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1011
Summary {0: 1, 1: 1, 2: 5, 3: 113, 4: 891}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007035_1020007040 -10 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007040 7:4788629-4788651 CACGCCAGCCTTTGTCCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 83
1020007035_1020007048 21 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007048 7:4788660-4788682 TCCCGGGTGTGCTGACGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1020007035_1020007043 4 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007035_1020007047 20 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 81
1020007035_1020007050 22 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007050 7:4788661-4788683 CCCGGGTGTGCTGACGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 125
1020007035_1020007045 5 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007035 Original CRISPR GGCTGGCGTGGGCTGAGGGC AGG (reversed) Intronic