ID: 1020007036

View in Genome Browser
Species Human (GRCh38)
Location 7:4788620-4788642
Sequence CAAAGGCTGGCGTGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007036_1020007043 0 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007036_1020007048 17 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007048 7:4788660-4788682 TCCCGGGTGTGCTGACGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1020007036_1020007045 1 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007036_1020007050 18 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007050 7:4788661-4788683 CCCGGGTGTGCTGACGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 125
1020007036_1020007047 16 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007036 Original CRISPR CAAAGGCTGGCGTGGGCTGA GGG (reversed) Intronic