ID: 1020007037

View in Genome Browser
Species Human (GRCh38)
Location 7:4788621-4788643
Sequence ACAAAGGCTGGCGTGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 356}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007037_1020007045 0 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007037_1020007048 16 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007048 7:4788660-4788682 TCCCGGGTGTGCTGACGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1020007037_1020007050 17 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007050 7:4788661-4788683 CCCGGGTGTGCTGACGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 125
1020007037_1020007043 -1 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007037_1020007047 15 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007037 Original CRISPR ACAAAGGCTGGCGTGGGCTG AGG (reversed) Intronic