ID: 1020007038

View in Genome Browser
Species Human (GRCh38)
Location 7:4788627-4788649
Sequence ATCGGGACAAAGGCTGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007038_1020007050 11 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007050 7:4788661-4788683 CCCGGGTGTGCTGACGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 125
1020007038_1020007045 -6 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007045 7:4788644-4788666 CCCGATGGCTTTACTGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1020007038_1020007047 9 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 81
1020007038_1020007054 28 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007054 7:4788678-4788700 CAGGGGTCTCCCCAAACCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 244
1020007038_1020007053 27 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007053 7:4788677-4788699 CCAGGGGTCTCCCCAAACCCAGG 0: 1
1: 0
2: 1
3: 33
4: 272
1020007038_1020007043 -7 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007038_1020007048 10 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007048 7:4788660-4788682 TCCCGGGTGTGCTGACGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1020007038_1020007055 29 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007055 7:4788679-4788701 AGGGGTCTCCCCAAACCCAGGGG 0: 1
1: 0
2: 3
3: 31
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007038 Original CRISPR ATCGGGACAAAGGCTGGCGT GGG (reversed) Intronic