ID: 1020007043

View in Genome Browser
Species Human (GRCh38)
Location 7:4788643-4788665
Sequence TCCCGATGGCTTTACTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007035_1020007043 4 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007033_1020007043 14 Left 1020007033 7:4788606-4788628 CCACAGGCCTCCTGCCCTCAGCC 0: 1
1: 4
2: 10
3: 123
4: 1055
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007038_1020007043 -7 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007039_1020007043 -8 Left 1020007039 7:4788628-4788650 CCACGCCAGCCTTTGTCCCGATG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007036_1020007043 0 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007037_1020007043 -1 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007031_1020007043 25 Left 1020007031 7:4788595-4788617 CCTGGGACCGGCCACAGGCCTCC 0: 1
1: 0
2: 1
3: 20
4: 276
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007034_1020007043 7 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007032_1020007043 18 Left 1020007032 7:4788602-4788624 CCGGCCACAGGCCTCCTGCCCTC 0: 1
1: 0
2: 5
3: 78
4: 738
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007043 Original CRISPR TCCCGATGGCTTTACTGTCC CGG Intronic