ID: 1020007043

View in Genome Browser
Species Human (GRCh38)
Location 7:4788643-4788665
Sequence TCCCGATGGCTTTACTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007034_1020007043 7 Left 1020007034 7:4788613-4788635 CCTCCTGCCCTCAGCCCACGCCA 0: 1
1: 0
2: 8
3: 140
4: 1728
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007039_1020007043 -8 Left 1020007039 7:4788628-4788650 CCACGCCAGCCTTTGTCCCGATG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007032_1020007043 18 Left 1020007032 7:4788602-4788624 CCGGCCACAGGCCTCCTGCCCTC 0: 1
1: 0
2: 5
3: 78
4: 738
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007033_1020007043 14 Left 1020007033 7:4788606-4788628 CCACAGGCCTCCTGCCCTCAGCC 0: 1
1: 4
2: 10
3: 123
4: 1055
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007035_1020007043 4 Left 1020007035 7:4788616-4788638 CCTGCCCTCAGCCCACGCCAGCC 0: 1
1: 1
2: 5
3: 113
4: 891
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007036_1020007043 0 Left 1020007036 7:4788620-4788642 CCCTCAGCCCACGCCAGCCTTTG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007038_1020007043 -7 Left 1020007038 7:4788627-4788649 CCCACGCCAGCCTTTGTCCCGAT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007037_1020007043 -1 Left 1020007037 7:4788621-4788643 CCTCAGCCCACGCCAGCCTTTGT 0: 1
1: 0
2: 3
3: 29
4: 356
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1020007031_1020007043 25 Left 1020007031 7:4788595-4788617 CCTGGGACCGGCCACAGGCCTCC 0: 1
1: 0
2: 1
3: 20
4: 276
Right 1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007043 Original CRISPR TCCCGATGGCTTTACTGTCC CGG Intronic
900316401 1:2059286-2059308 CTCTGATGGCTTTGCTGTCCAGG + Intronic
912489397 1:110053592-110053614 TCCCCATGGATTCACTGGCCAGG - Intronic
915349312 1:155214581-155214603 TCCCGATGGCTCTGCTGTTGTGG - Intergenic
915352499 1:155235208-155235230 TCCCGATGGCTCTGCTGTTGTGG - Exonic
919759416 1:201087911-201087933 TCCCGATGGCATCATTGACCTGG + Exonic
923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG + Intergenic
1075960336 10:126562785-126562807 GCCTGATGGTTTTACTGTCCTGG - Intronic
1082735815 11:56854527-56854549 TCCTGATGGATCTTCTGTCCGGG + Intergenic
1086406944 11:86506751-86506773 TCCCCATGGTTGAACTGTCCAGG + Intronic
1090367014 11:126215076-126215098 TCCCAATGACTGTACTTTCCAGG - Intronic
1094469997 12:30794836-30794858 TCCCGAAGGCTCTAATGTCATGG - Intergenic
1100409393 12:94299965-94299987 TCCCAACAGCTCTACTGTCCTGG - Intronic
1116436337 14:44898109-44898131 TTCCGCTGGCTTTATTCTCCAGG - Intronic
1125748086 15:42010981-42011003 TCCCGATGTCTTTTAGGTCCTGG - Intronic
1132011023 15:98276790-98276812 TCACGATGGCTCTACTGTTGTGG - Intergenic
1135571980 16:23556731-23556753 TCCAGAAGGCTTTACTGAGCAGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1139340451 16:66264772-66264794 TCCCGCTGGCTGTCCTGCCCGGG - Intergenic
1157451486 18:47792369-47792391 TCCAAATGGCTCTCCTGTCCCGG - Intergenic
1160276788 18:77444509-77444531 CCGCGATGGCTATACTGTGCAGG - Intergenic
1160441241 18:78894480-78894502 TCAGGATGGGTTGACTGTCCTGG + Intergenic
1161518793 19:4712066-4712088 TCCCGTTGGGGTTGCTGTCCTGG - Intronic
925976635 2:9146499-9146521 TCCCCCTGGATTTCCTGTCCTGG + Intergenic
928065685 2:28162248-28162270 GCCCTTTGTCTTTACTGTCCCGG - Intronic
929887182 2:45889302-45889324 TCTCTAGGGCTTTGCTGTCCTGG - Intronic
930825534 2:55693386-55693408 TTCCGATCTCTTTACTTTCCGGG - Intronic
932712732 2:74079950-74079972 ACCAGATGTGTTTACTGTCCAGG + Intronic
933627740 2:84620791-84620813 TTCCAATGGCTTGACTGTCATGG - Intronic
935315697 2:101831533-101831555 TCTCGGTGGCTTTACTGTGGAGG + Intronic
941292497 2:163694622-163694644 TCCCAGTGACTTTACTTTCCTGG - Intronic
1173742707 20:45412694-45412716 TCCCAATAGCTTTGCTGTGCAGG + Intergenic
1178820028 21:35966607-35966629 TGCCCAAGGCTCTACTGTCCAGG - Intronic
1183645335 22:39123229-39123251 TCCCGCTGGCCTGACTGCCCTGG + Intronic
950452050 3:13071045-13071067 TCCGGATGATTTTAATGTCCAGG - Intronic
953550081 3:43895020-43895042 TGCGGGTGGCTTTCCTGTCCAGG - Intergenic
956432788 3:69204340-69204362 TCCTGATGTCTTTCCTGTCCTGG - Intronic
958040955 3:88225753-88225775 TCCCAATGTCTTTACTTTCAGGG - Intergenic
964159949 3:153634861-153634883 TCCCCATGGAGTTACTGTTCTGG + Intergenic
964754282 3:160080025-160080047 TCTCCATGGATCTACTGTCCTGG + Intergenic
968908707 4:3466047-3466069 TCCCGGTGGCTTTTCTGAGCTGG - Intronic
969178823 4:5421683-5421705 TCCCCATGGCTCTGCTTTCCTGG - Intronic
978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG + Intronic
985694073 5:1330146-1330168 TCCCGATGGCCTCAGTGTTCTGG - Intronic
995448948 5:112279241-112279263 TTCGGATGGCTTTGCAGTCCAGG + Intronic
998640651 5:144006757-144006779 TCCAGATGGCTTCACTCTTCTGG - Intergenic
999905020 5:156131283-156131305 TCCAGATGGTTTTACTTTCTGGG + Intronic
1008659443 6:53651438-53651460 TCCTGATGGCTTTAAATTCCTGG - Exonic
1009862645 6:69354487-69354509 TCCAGATGGCTTCAGAGTCCAGG + Intronic
1020007043 7:4788643-4788665 TCCCGATGGCTTTACTGTCCCGG + Intronic
1026209838 7:68294331-68294353 TCCTGATGGCTTTGCTGCACTGG - Intergenic
1039490364 8:37942980-37943002 TCCCCTTGGCTCTACTGTCCTGG + Intergenic
1047367559 8:124225963-124225985 TCCCATTGGCTTTTCTATCCTGG - Intergenic
1049513867 8:143043438-143043460 TCCTGATGGCTTTGATGTTCAGG - Intronic
1050122764 9:2324931-2324953 TGCTGATGGCTTTTCTTTCCAGG - Intergenic
1052752220 9:32503413-32503435 TCCCACTGCCTTTGCTGTCCTGG + Intronic
1056908732 9:90678245-90678267 CCCCTATGGCATTACAGTCCAGG + Intergenic
1057747174 9:97761600-97761622 TCCCAAGTGCTTCACTGTCCTGG - Intergenic
1058262721 9:102856287-102856309 TTCCTATGGCTTTACTTTCTGGG + Intergenic
1203759739 EBV:6005-6027 TCCAGATGGGTGTATTGTCCGGG - Intergenic
1202597325 Y:26554733-26554755 TCCCTAAAGCTTAACTGTCCAGG + Intergenic