ID: 1020007397

View in Genome Browser
Species Human (GRCh38)
Location 7:4789912-4789934
Sequence CGCTGCCGGTGTGCACAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020007390_1020007397 -8 Left 1020007390 7:4789897-4789919 CCCGGCCCCAGGGTACGCTGCCG 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1020007397 7:4789912-4789934 CGCTGCCGGTGTGCACAGGTAGG 0: 1
1: 0
2: 1
3: 13
4: 94
1020007391_1020007397 -9 Left 1020007391 7:4789898-4789920 CCGGCCCCAGGGTACGCTGCCGG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1020007397 7:4789912-4789934 CGCTGCCGGTGTGCACAGGTAGG 0: 1
1: 0
2: 1
3: 13
4: 94
1020007386_1020007397 16 Left 1020007386 7:4789873-4789895 CCTGGGCAGGAGCGACTCGCTCT 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1020007397 7:4789912-4789934 CGCTGCCGGTGTGCACAGGTAGG 0: 1
1: 0
2: 1
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020007397 Original CRISPR CGCTGCCGGTGTGCACAGGT AGG Exonic
900939187 1:5786910-5786932 GGCTGCTGGTGTGCAGAGGAAGG - Intergenic
902757459 1:18558355-18558377 CACTGCCTGCCTGCACAGGTGGG - Intergenic
903377473 1:22875970-22875992 GGCTGCCAGTGTGGACAGCTTGG + Intronic
904485900 1:30824460-30824482 CGCCGCCGGTGTAGACAGCTGGG + Intergenic
910461342 1:87451016-87451038 CGTGGCTGATGTGCACAGGTAGG - Intergenic
912416071 1:109509213-109509235 GGCTGCAGGTATGCACAGGATGG + Intronic
912739670 1:112182450-112182472 CGCTCCCGGTGAGCACATCTGGG + Intergenic
914318569 1:146537335-146537357 CGTGGCCGATGTGCACAGGTAGG - Intergenic
914495791 1:148196022-148196044 CGTGGCCGATGTGCACAGGTAGG + Intergenic
914923610 1:151864786-151864808 CGTTGCCTGCCTGCACAGGTTGG - Intergenic
915300204 1:154947402-154947424 AGCTGCAGGTGGGCACAGGCAGG - Exonic
1062940432 10:1416819-1416841 CGCTGCCAATGTGAAAAGGTTGG - Intronic
1067718063 10:48704663-48704685 AGCTGCCTGTGTGCACTGCTGGG + Intronic
1069535338 10:69248711-69248733 GGCTGCCGGACGGCACAGGTGGG + Exonic
1069617841 10:69817594-69817616 TGCTGCCTGTGTGCAGGGGTGGG + Intronic
1070892761 10:79954340-79954362 CGCTGTTGGTGACCACAGGTGGG + Intronic
1076850121 10:133088536-133088558 CGGTGCCGGTGGGGACCGGTGGG - Intronic
1077273571 11:1693081-1693103 CTCTGACGGTGTGCACGGGCGGG + Intergenic
1080855729 11:36110077-36110099 TGCTGCCTTTGTGTACAGGTGGG + Intronic
1083728797 11:64642466-64642488 CGCTTCCCGTGTGCGCAGCTGGG - Intronic
1084705646 11:70814665-70814687 CCCTGCCTGTGTGGCCAGGTGGG + Intronic
1090972050 11:131652613-131652635 CTCTGCCTCTGTCCACAGGTAGG - Intronic
1091583526 12:1802832-1802854 GGCTGCCGGTGTGCAGAGGAAGG - Intronic
1095296185 12:40530258-40530280 CACTGCAGCTGTGCATAGGTGGG - Intronic
1100619421 12:96256836-96256858 CGGGGCAGGGGTGCACAGGTGGG + Intronic
1100631991 12:96399452-96399474 CGCTGGCGCTGTGCGCGGGTGGG - Intronic
1103252520 12:119512518-119512540 TGCTGCAGGAGTCCACAGGTGGG + Intronic
1105306031 13:19169804-19169826 TGATGCCGGACTGCACAGGTGGG - Intergenic
1112507806 13:99985435-99985457 CGCCGCCGCTGGGGACAGGTTGG - Exonic
1113658567 13:112087453-112087475 CGCTGCCGGTGTGCTGGGGAGGG + Intergenic
1122921182 14:104880946-104880968 GGGTGCAGGCGTGCACAGGTAGG - Intronic
1202903941 14_GL000194v1_random:57984-58006 CACTGCGGGTGTGGACAGGTAGG - Intergenic
1128311670 15:66634794-66634816 CGCTGCTGGTGTGCAAATGCTGG + Intronic
1129810705 15:78507664-78507686 CGCTGCCGGTGAGCCAAGGAGGG + Intronic
1131962696 15:97806403-97806425 CTCTGCCAGTGTGCACATTTGGG - Intergenic
1132468046 16:86663-86685 GGCTGCTGGGGTGCGCAGGTGGG - Exonic
1132602640 16:780631-780653 AGGTGACAGTGTGCACAGGTAGG + Intronic
1132602658 16:780760-780782 AGGTGACGGTGTGCACGGGTAGG + Intronic
1132602662 16:780780-780802 AGGTGACGGTGTGCACGGGTAGG + Intronic
1132602688 16:780961-780983 AGGTGACGGTGTGCAGAGGTAGG + Intronic
1132808678 16:1787498-1787520 CGCTGCAGGAGTGCAAAGATGGG - Intronic
1137442894 16:48511185-48511207 TGCTGGTGGTGGGCACAGGTGGG + Intergenic
1139340950 16:66267526-66267548 CGCTCCCACTGTGCACAGGTGGG + Intergenic
1139588188 16:67917733-67917755 AGCTGCCTGTGGGCACAGGCAGG + Intronic
1140696088 16:77535645-77535667 GGCTGCAGGTGTGAAGAGGTGGG + Intergenic
1142855306 17:2725923-2725945 AGCTGCCAGTGTGCACAGGAAGG + Intergenic
1143247816 17:5500830-5500852 CGCTGCCCGCGGGCCCAGGTCGG - Intronic
1148438283 17:47698683-47698705 GGCTGGCGGTGGGCTCAGGTTGG - Exonic
1152878521 17:82802181-82802203 AGCGGCCGGTGTGAACGGGTTGG + Intronic
1160719630 19:591481-591503 CGGGGCCGGTGTGCACCGGTGGG + Intronic
1161138616 19:2635211-2635233 GGGTGCAGGTGGGCACAGGTGGG + Intronic
1161950962 19:7467695-7467717 AGCAGCCAGTGTGCGCAGGTTGG + Intronic
1162016252 19:7848015-7848037 TGCTGCCGCTGTGCCCAGGCTGG - Intronic
1163634248 19:18431057-18431079 TGCCGCAGGTGTGCCCAGGTGGG + Intronic
1163866257 19:19776006-19776028 CTCTGAAGTTGTGCACAGGTAGG + Intergenic
1163895270 19:20052808-20052830 CTCTGAAGTTGTGCACAGGTGGG - Intergenic
1167525056 19:49978505-49978527 TGCTGCCTGTGTGCACAGCCCGG - Intronic
935927006 2:108080355-108080377 GGCTGCAGCTGTGCACAGCTGGG + Intergenic
937441631 2:121920412-121920434 CAATGCCAGGGTGCACAGGTGGG - Intergenic
938314633 2:130317346-130317368 CACTGCAGGTGTGGACAGGTGGG + Intergenic
946174354 2:217913391-217913413 TGCAGCCGGCTTGCACAGGTTGG + Intronic
948858651 2:240742479-240742501 CTCTGCCTGTGGGAACAGGTGGG - Intronic
1174348432 20:49949100-49949122 GGCTGCTGATGTGCACAGGAAGG + Intronic
1175387200 20:58604848-58604870 CCCTGCCGGCTTTCACAGGTGGG - Intergenic
1176623311 21:9072752-9072774 CACTGTGGGTGTGGACAGGTAGG - Intergenic
1178351367 21:31874445-31874467 AGCTGCCGGAGCCCACAGGTGGG - Intronic
1179780064 21:43693951-43693973 AGCTGGGGGTGTGGACAGGTAGG + Exonic
1179979574 21:44889081-44889103 CGCGGCAGGTGCGCACAGGAGGG + Intronic
1180252093 21:46596605-46596627 CCCTGCTGGTGGGTACAGGTGGG + Intergenic
1183062457 22:35344556-35344578 CGGAGCCGGTGTGCACAGCTGGG + Intronic
1184476530 22:44725081-44725103 CCCTGCAGGTCTGGACAGGTGGG + Intronic
1185273831 22:49941391-49941413 CTCTGCTGCTGAGCACAGGTGGG + Intergenic
1185343401 22:50301266-50301288 GGCTGCAGCTGTGCCCAGGTTGG - Intronic
950727608 3:14927224-14927246 CTTTGCCTGTGTCCACAGGTGGG + Intronic
953246909 3:41200923-41200945 GGCTGCTGGTATGCAGAGGTCGG + Intronic
963047635 3:141114584-141114606 CCCTGCCAGTGTGCCCAGGCTGG - Intronic
964284524 3:155102888-155102910 CTCTGCCGGTGTGGACAGGTAGG - Intronic
986314592 5:6578124-6578146 CGATGTCTCTGTGCACAGGTGGG + Intergenic
988591391 5:32552986-32553008 GGCTGCCGGAGTGCCCAGGCTGG - Intronic
1006150401 6:31983949-31983971 CGGTGCTGGTGGGCAGAGGTGGG - Intronic
1006156702 6:32016687-32016709 CGGTGCTGGTGGGCAGAGGTGGG - Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013457018 6:110339228-110339250 AGCTGCAGGAGTGCACAGATAGG - Intronic
1017704707 6:157111380-157111402 CGCACCAGGGGTGCACAGGTAGG - Intronic
1017796489 6:157849532-157849554 CGCAGCAGGTGTGCAGAGGCTGG + Intronic
1019708679 7:2508466-2508488 CGCTGCCACTCTGCACATGTGGG - Intergenic
1020007397 7:4789912-4789934 CGCTGCCGGTGTGCACAGGTAGG + Exonic
1020271402 7:6598624-6598646 GGCTGCCTGTGTGCACAGGAGGG - Intronic
1022475372 7:30706465-30706487 CACTGGCGGGGTGCACGGGTTGG - Intronic
1029373906 7:100166728-100166750 CGCTGCCGGGGTGGGCAGGACGG + Exonic
1030560682 7:111081491-111081513 CACTCCCTCTGTGCACAGGTTGG - Intronic
1032705182 7:134415142-134415164 AGCTGCAGGTGTGCCCAGGCAGG - Intergenic
1034263330 7:149770435-149770457 CACTGGGGGTGTGCTCAGGTAGG - Exonic
1034345820 7:150384579-150384601 CTCTACCTGTGTGCTCAGGTGGG - Intronic
1035221675 7:157409994-157410016 CGCAGCAGGTGTGCAAAGGGAGG + Exonic
1039102664 8:33957748-33957770 CACTGCCGGTGTGTTCAGGCTGG - Intergenic
1043173979 8:77000618-77000640 CGGGGCCTGTGTGCACAGGGAGG + Intronic
1044242289 8:89902086-89902108 CGCTGCCGGGGTGCAGACGCCGG - Intronic
1046131777 8:109975056-109975078 CGCTGGGGGTGTGAGCAGGTGGG + Exonic
1050175626 9:2866860-2866882 CTCTGCCAGTGTCCACAGGATGG - Intergenic
1052982092 9:34457492-34457514 AGCTGCCTGTGCGCACTGGTTGG - Intronic
1062203858 9:135324638-135324660 CGGTGCAGGTGGGCACAGGAGGG + Intergenic
1062259915 9:135656327-135656349 CTCTGCAGGTGTGCACCTGTGGG + Intergenic
1062635628 9:137489095-137489117 CTCTGCAGGGGTGCACAGTTGGG - Intronic
1203746496 Un_GL000218v1:43179-43201 CACTGCGGGTGTGGACAGGTAGG - Intergenic
1203563612 Un_KI270744v1:76301-76323 CACTGCGGGTGTGGACAGGTAGG + Intergenic
1189465593 X:41275866-41275888 CGCTGCGGGGCTGCTCAGGTTGG + Intergenic
1201077105 Y:10196653-10196675 CGCTGCCGGGGGCCACTGGTTGG + Intergenic
1201159826 Y:11158193-11158215 CACTGCGGGTGTGGACAGGTAGG - Intergenic