ID: 1020008072

View in Genome Browser
Species Human (GRCh38)
Location 7:4792677-4792699
Sequence GGCCGCTGAGCCGGGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 403}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020008057_1020008072 27 Left 1020008057 7:4792627-4792649 CCGAGCTCCAGGACGGCTGGTGT 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403
1020008063_1020008072 1 Left 1020008063 7:4792653-4792675 CCGCGGCCTGCGATGACAGCCCA 0: 1
1: 0
2: 2
3: 4
4: 84
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403
1020008066_1020008072 -5 Left 1020008066 7:4792659-4792681 CCTGCGATGACAGCCCAGGGCCG 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403
1020008058_1020008072 20 Left 1020008058 7:4792634-4792656 CCAGGACGGCTGGTGTCCCCCGC 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403
1020008062_1020008072 2 Left 1020008062 7:4792652-4792674 CCCGCGGCCTGCGATGACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403
1020008060_1020008072 4 Left 1020008060 7:4792650-4792672 CCCCCGCGGCCTGCGATGACAGC 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403
1020008061_1020008072 3 Left 1020008061 7:4792651-4792673 CCCCGCGGCCTGCGATGACAGCC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG 0: 1
1: 0
2: 4
3: 40
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020008072 Original CRISPR GGCCGCTGAGCCGGGGCCGC AGG Intronic
900117425 1:1034531-1034553 GGGCGCAGAGCCGGAGCCCCGGG + Intronic
900413898 1:2526383-2526405 GGCCGGCGAGCGGGGGCGGCGGG - Intronic
900479708 1:2892057-2892079 GGCCTCTGAGCCAGGGCAGCTGG - Intergenic
900513025 1:3069339-3069361 GGCCGCCGGGCCGGGGCGCCCGG + Intronic
900933883 1:5753424-5753446 AGCCTCTGAGCCGGGGGTGCTGG - Intergenic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901443402 1:9292954-9292976 GGCGCCGGGGCCGGGGCCGCGGG + Exonic
902451291 1:16498654-16498676 GGCCACGGAGGCAGGGCCGCCGG - Intergenic
902501582 1:16914628-16914650 GGCCACGGAGGCAGGGCCGCCGG + Intronic
902585803 1:17438181-17438203 GGGCGCAGGGCCGGGGCCGGCGG - Intronic
902747309 1:18482430-18482452 GGCCCCGGAGCCGGCGCTGCAGG - Exonic
903212983 1:21829033-21829055 AGCCGCTGGCCCTGGGCCGCTGG - Exonic
903413717 1:23167883-23167905 GGCGGCTGGGCGGGGGCCGGGGG + Intronic
903883798 1:26529869-26529891 GGCGGCGCAGCCGGGGCCGCCGG + Intronic
905221468 1:36450711-36450733 GGCCGCTGGCGCGGGGCCTCAGG + Intergenic
906615831 1:47232238-47232260 GGCGGGGGAGCGGGGGCCGCGGG - Intergenic
908511176 1:64850974-64850996 GTCTGCTGAGCCGGGGCCGTGGG + Intronic
913016148 1:114737502-114737524 GGACTCTGACCCGGGGCAGCTGG + Exonic
913109114 1:115642057-115642079 GGCCGCGGAGCTCGGGCGGCCGG + Exonic
913240454 1:116825593-116825615 AGCAGCTGAGCCGGGGCTGGGGG - Intergenic
913451076 1:118993082-118993104 GCCGGCAGAGCCGGGGCCGGCGG + Intergenic
914902360 1:151717486-151717508 GGCCGCGGAGGCGGCGCCGCGGG + Intronic
916666953 1:166975409-166975431 GGCCGCGCAGGCGGGGCCGGGGG + Intronic
917291615 1:173477259-173477281 GGCGGCGGGGGCGGGGCCGCGGG - Exonic
920805705 1:209231808-209231830 GACCGCGGGGCCGGGGTCGCGGG + Intergenic
920805777 1:209232053-209232075 GTCAGCTGGGCCGGCGCCGCCGG + Intergenic
922518225 1:226223812-226223834 GGTCGCTGGGCCGGGGCCCGCGG - Exonic
922851363 1:228736012-228736034 GGCCGGGGGGCCGGGGCCGGGGG + Intronic
923478192 1:234356992-234357014 GGCGGCTGAACCGGGGCCTGCGG - Intergenic
924436921 1:244049642-244049664 GGGCGCAGAGCCGGTGCAGCAGG - Intronic
1062913426 10:1229309-1229331 AGCCCCTGAGCCTGGGCCTCGGG + Intronic
1063443094 10:6089206-6089228 GGCCACCCACCCGGGGCCGCCGG - Intronic
1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG + Intergenic
1067596873 10:47565476-47565498 GGTCGCTGGGCCCGGGCCGCCGG - Intergenic
1069615065 10:69801729-69801751 GGCCGGCGGGCTGGGGCCGCCGG + Intergenic
1072253800 10:93601468-93601490 GGTAACTGAGCCAGGGCCGCTGG - Exonic
1073578054 10:104641463-104641485 GGCCGCGAAGCCGGGGCCGCCGG - Exonic
1074978038 10:118596460-118596482 GGCAGCTGAGCCGGGGGCCTGGG + Intergenic
1076149255 10:128149797-128149819 GGCCGCTGCGCAGGGGGCGCGGG - Intergenic
1076218933 10:128717672-128717694 AGCCCCTGAGCCTGGGCCTCTGG - Intergenic
1076834935 10:133016303-133016325 CGGCGCTGAGCCGGGGCCTCCGG + Intergenic
1076844162 10:133060871-133060893 GGCAGCTGAGAGGGGGCGGCAGG - Intergenic
1076947894 10:133664701-133664723 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076948884 10:133668011-133668033 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
1076949868 10:133671310-133671332 GCCCGCTCAAGCGGGGCCGCAGG + Intronic
1076950852 10:133674609-133674631 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076951842 10:133677919-133677941 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076952831 10:133681229-133681251 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076953815 10:133684528-133684550 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076954799 10:133740880-133740902 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076955788 10:133744190-133744212 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076956778 10:133747500-133747522 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076957765 10:133750809-133750831 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076958750 10:133754108-133754130 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076959739 10:133757418-133757440 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076960723 10:133760717-133760739 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
1076993810 11:289039-289061 GGTCGCTGGGCCGGGCCCGGGGG - Intergenic
1077014724 11:394487-394509 GGCCGCTGAGCCCGAGCCTGAGG + Exonic
1077065659 11:640019-640041 GGGCGCACAGTCGGGGCCGCAGG - Exonic
1077065680 11:640067-640089 GGGCGCACAGTCGGGGCCGCAGG - Exonic
1077065698 11:640115-640137 GGGCGCACAGTCGGGGCCGCAGG - Exonic
1077554220 11:3218219-3218241 TGCCGTAGAGCCTGGGCCGCGGG + Exonic
1079071814 11:17353562-17353584 GGCCCCTGAGGAGGGGGCGCCGG - Intronic
1080873664 11:36258415-36258437 GCCCACTGAGCCGGGGAGGCTGG + Intergenic
1080886853 11:36376007-36376029 GGCAGCTGGGCCGGGGGCGGGGG + Exonic
1081773244 11:45662466-45662488 GGGGGGTGTGCCGGGGCCGCTGG + Intronic
1081807844 11:45900005-45900027 GGGAGCCGAGCAGGGGCCGCCGG - Intronic
1083457134 11:62786808-62786830 GGCCGCGGAGCCGTGGGTGCAGG - Exonic
1083855385 11:65390625-65390647 GGCCGAGGAGCCGGGGCAGCAGG - Intronic
1083920752 11:65780565-65780587 GGCCCCTGAGCCGGGACGCCTGG - Exonic
1084207048 11:67601263-67601285 GGCCCCTGAGCTGGGCCAGCAGG + Intergenic
1084212986 11:67632381-67632403 GGACACTGAGCAGGGGCCGTGGG + Exonic
1084376714 11:68782961-68782983 GGAGCCTGAGCCGGCGCCGCGGG - Intronic
1084979783 11:72822902-72822924 GGCCCCTGAGCCAGAGCCCCTGG + Exonic
1085044016 11:73343110-73343132 AGCCGCTGGGGCGGGGGCGCCGG - Intronic
1085332828 11:75667758-75667780 GGCCGCAGAGCCAGGAGCGCTGG - Exonic
1086666598 11:89491340-89491362 GGCCGCTGAGCGAGGACCGAGGG + Exonic
1088588337 11:111379410-111379432 GCGCTCTGGGCCGGGGCCGCTGG - Exonic
1088892982 11:114059374-114059396 GGCCGGTGAGAGGCGGCCGCCGG + Intergenic
1089273213 11:117315696-117315718 GGCCGCTGCGCAGGGGCAGCCGG + Exonic
1089604720 11:119635240-119635262 GGCCGCTGAGCTTGGCCCCCAGG + Intronic
1090976916 11:131686978-131687000 GGCAGCGGAGCCCAGGCCGCAGG + Intronic
1091996472 12:4997800-4997822 GGCGGCTGAGCCAGGGACTCTGG + Intergenic
1094570557 12:31637747-31637769 AGCCACTGTGCCGGGGCAGCAGG + Intergenic
1094834707 12:34316874-34316896 GGGCACTGAGCAGGGGCTGCTGG + Intergenic
1095875873 12:47079775-47079797 GCTCCCAGAGCCGGGGCCGCGGG + Exonic
1096389394 12:51217464-51217486 GGATGCTGGGCCGGGGCGGCGGG - Intronic
1096389404 12:51217485-51217507 AGCCGCGGGGCCGGGGCGGCGGG - Intronic
1096482414 12:51951585-51951607 GGCCGCGGCGCCGGCTCCGCCGG + Intergenic
1097264504 12:57737805-57737827 GGCTGCTGAGCAGGGGGCGCCGG + Exonic
1098320650 12:69239937-69239959 GGCCGCTGTGCAGCTGCCGCCGG + Intronic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1101723449 12:107370661-107370683 GGCTGCTGAGCCTGTGCTGCTGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1103407659 12:120687186-120687208 GGCCGCTCCGCCTGAGCCGCCGG - Exonic
1103474811 12:121210435-121210457 AGCCGCCGCGCCGGGGCCCCGGG + Intronic
1103749771 12:123150840-123150862 GCCGGCCGGGCCGGGGCCGCGGG - Intergenic
1104448815 12:128853484-128853506 GGCGGGGGAGCCGGGGCGGCTGG - Intronic
1104568237 12:129903773-129903795 GGCTGCGGAGCCCGGGACGCGGG + Intergenic
1104602451 12:130162675-130162697 GGCCGCTGCGCCGGGAGCTCCGG + Exonic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104891906 12:132144233-132144255 GGCAGCTGCGGCGGGGCCGGAGG - Exonic
1104918263 12:132277653-132277675 GCCAGCAGAGCCGGGGCCGCGGG - Intronic
1106246390 13:27953911-27953933 GGAGGCTGAGCAGGGGCAGCCGG - Intergenic
1106358093 13:29003812-29003834 GGAGGCTGTGCCAGGGCCGCAGG - Intronic
1107548884 13:41457461-41457483 GGCTGCGGAGCCGGGGCGACGGG - Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1110713648 13:78677191-78677213 GGCCTCTGTGCCAGGGCCACAGG + Intergenic
1112054517 13:95677532-95677554 GGCCGCGGGGCCGGGACAGCGGG + Intronic
1112271863 13:97976365-97976387 GGCCGCGCATCGGGGGCCGCCGG - Intronic
1112319446 13:98393892-98393914 GGCCTCTGAGCCCAGGCTGCCGG - Intronic
1113378795 13:109785518-109785540 GGCGGCTCTGCCGGCGCCGCCGG - Exonic
1113494215 13:110714662-110714684 GGGCGCCGAGACGGGGCTGCAGG + Intronic
1113768441 13:112894613-112894635 GGACGCTGGGCAGGGGCCGCGGG - Intronic
1113786047 13:113002528-113002550 GGCCGCCCAGCCGGGTCCACAGG - Intronic
1113847231 13:113399322-113399344 GGCCACTGCACCTGGGCCGCGGG - Intergenic
1113894166 13:113752827-113752849 GGCCACAGAGCCGGCGCGGCCGG - Intergenic
1118220806 14:63853234-63853256 GGTCTCTGAGCCGGGGGCGGGGG + Intronic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121595093 14:95156773-95156795 GGCCGCTGTGCCGCGCCCGGAGG - Intronic
1122290550 14:100678343-100678365 GGACGCTGAGCTGGGGGCCCAGG + Intergenic
1122412369 14:101532242-101532264 GGCTGCTGAGACGTGGCTGCTGG + Intergenic
1122418380 14:101560989-101561011 GGCCGCTGCCCAGGTGCCGCGGG - Intergenic
1122685221 14:103501210-103501232 GGCAGCAGAGCTGGGGCTGCTGG - Intronic
1122693289 14:103541492-103541514 GGCCTCTGTCTCGGGGCCGCCGG + Intergenic
1122771120 14:104098427-104098449 GGCTCCTGAGCAGGGGCCTCAGG + Intronic
1122788844 14:104176055-104176077 GGCCCCTGAGGGGGGGCCCCTGG + Exonic
1122862465 14:104588702-104588724 GGCCGAGGAGCCGGGCCCGCAGG - Exonic
1202864198 14_GL000225v1_random:104693-104715 GCCCGCTCAGGCGGGGCCACAGG - Intergenic
1125882940 15:43209331-43209353 GGCCGGTGAGCCACTGCCGCAGG + Exonic
1127449812 15:59105427-59105449 GGCCGCAGGGCCAGGGACGCGGG - Intronic
1128092260 15:64926924-64926946 GGCAGCTGAGCACGGGCAGCTGG + Exonic
1128323379 15:66707514-66707536 GGCCGCTGAGCCGGGCAGGGCGG - Intronic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1129607551 15:77032207-77032229 GGCCGGTGGGTGGGGGCCGCTGG + Intronic
1129660671 15:77551160-77551182 GGCTGCTGTGCCTGGGCCACGGG + Intergenic
1129676001 15:77632688-77632710 CGCCGCGGGGCCGGGGCCGGCGG + Intronic
1131227635 15:90638572-90638594 GGCTGCTGGGCAGGGGCCTCAGG - Exonic
1132064064 15:98716011-98716033 GGCTGCTGAGCCATGGGCGCTGG - Intronic
1132566426 16:625604-625626 GGGTGCAGAGCCGGGGCCACAGG - Intronic
1132613418 16:828832-828854 GCCTGCTGCTCCGGGGCCGCTGG + Intergenic
1132682597 16:1149293-1149315 GGCCTGTGAGCCGGGGACCCAGG - Intergenic
1132719739 16:1309786-1309808 GGGGGCCGGGCCGGGGCCGCGGG + Intronic
1132786312 16:1658690-1658712 GGCTGCTGAGCCGCTGTCGCAGG + Intronic
1132883792 16:2173601-2173623 GGCCTCCCTGCCGGGGCCGCCGG - Intronic
1132972771 16:2697009-2697031 GACCGGTGAGCCTGGGCGGCAGG - Intronic
1132977993 16:2720032-2720054 GGGGGCTGAGCCGGAGCCCCAGG + Intronic
1133026618 16:2991443-2991465 GGTGGCTGGGCAGGGGCCGCAGG + Intergenic
1133259468 16:4538706-4538728 GGCCGCTGCCCCAGGGCTGCGGG - Intronic
1133272361 16:4616438-4616460 GGGCGCTGGGCCGGGGAGGCCGG + Intergenic
1133327189 16:4948961-4948983 GGCCGCTGGGGAGGGGCCACAGG - Intronic
1135517710 16:23149313-23149335 GGCGGCCGTGGCGGGGCCGCGGG - Intergenic
1136485538 16:30569830-30569852 GGCCACTGAGTCGGGGACTCCGG - Exonic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1137655316 16:50153818-50153840 GGCCGCGCCGCCGGGGCTGCCGG - Exonic
1138351214 16:56347268-56347290 GGCCGCGGAGCTGGAGCCTCAGG - Exonic
1139402877 16:66696409-66696431 AGCCGGTGAGCCAGCGCCGCGGG - Exonic
1139426082 16:66880739-66880761 GTCACCTGAGCCGGTGCCGCAGG - Intronic
1139534414 16:67562687-67562709 GGCGGCGGAGCGGGCGCCGCGGG + Exonic
1139600357 16:67982639-67982661 GGATGCTGCACCGGGGCCGCAGG - Intergenic
1141425378 16:83941337-83941359 GACTGCTGAGCCGGGCCCGGTGG + Intronic
1141553183 16:84819812-84819834 GGCAGCTGAGGCGCGGGCGCCGG - Intergenic
1141554295 16:84826825-84826847 GGCTGCTGAGCCGGGGCCCCAGG + Intronic
1141627271 16:85267892-85267914 GGCCACTTAGCTGGGGCCGACGG - Intergenic
1141706174 16:85666052-85666074 GGCCGCGGAGCCTGGGAAGCTGG + Exonic
1141989699 16:87602809-87602831 CGCCGCTGAGGTGGAGCCGCGGG + Intronic
1142253791 16:89004081-89004103 GGCCGAGGGGCAGGGGCCGCAGG + Intergenic
1142305121 16:89280436-89280458 CGTCGCTGAGCCGGGGCTGGAGG - Exonic
1142509849 17:386295-386317 GGCCGCAGAGCCCGGGCCGGAGG + Intergenic
1142672227 17:1492504-1492526 GGCCGCGGTGCCCAGGCCGCTGG - Exonic
1142683209 17:1562267-1562289 GGCATCTGAGCCGGGGCCCACGG - Intronic
1142852604 17:2711517-2711539 GGCCGCTGGGCGGGGGGCGCCGG - Intronic
1142876398 17:2853932-2853954 GCGCGCGGAGCCGGGGCTGCGGG + Intronic
1142902353 17:3019957-3019979 AGCCGCAGAGCCAGGGCCACAGG - Intronic
1143106613 17:4533462-4533484 GGGAGCTGGGCCTGGGCCGCGGG + Intronic
1143189760 17:5032943-5032965 GGCCCCTGAGCCTGGGCAGGTGG - Exonic
1143562675 17:7705027-7705049 GGGGGCTGAGGCGGGGCGGCGGG + Intergenic
1144764445 17:17725031-17725053 GGCTGCTGACCCTGGGCCTCGGG + Intronic
1145208176 17:20995594-20995616 GACCCCTGAGCTGGGGCAGCCGG - Intergenic
1146005125 17:29156002-29156024 GGGAGCTGAGCCTGGGCCCCAGG + Intronic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146079127 17:29761357-29761379 GGCGGCGGAGGCGGGCCCGCCGG + Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147150270 17:38510190-38510212 GGCCGCTCCTCCGGCGCCGCCGG - Exonic
1148081740 17:44970660-44970682 GGCCTGTGAGCTGGGGCCACCGG + Intergenic
1148090881 17:45021930-45021952 GTCCTCTGAGCCTGGGCTGCGGG - Intergenic
1148209320 17:45798758-45798780 GCACCCTGAGCCGGGGCCCCAGG + Intronic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148929968 17:51120323-51120345 GGCGGCAGGGCGGGGGCCGCGGG - Intronic
1149610500 17:57955256-57955278 GGCCGCAGGGGCCGGGCCGCGGG + Exonic
1151558730 17:74859994-74860016 GGCCCCGGAGCCGCGGACGCCGG - Intronic
1151657434 17:75502472-75502494 GGCCTTTGCGCCGGGCCCGCAGG + Exonic
1151696604 17:75721272-75721294 GGGCGCTGGGCGGGCGCCGCGGG + Intergenic
1151964843 17:77425910-77425932 GGCTGCTGTGCCGGCCCCGCAGG + Intronic
1152222196 17:79075016-79075038 GGCCCCGGAGGCGGGGACGCAGG + Exonic
1152423159 17:80204894-80204916 GACCGCTGAGCCTGTGCCCCTGG + Intronic
1152579905 17:81161261-81161283 GGCCGCTGTGCCGGAGAGGCAGG - Intronic
1152751573 17:82064940-82064962 GGCTGCTGAGCCGGCGCCACGGG - Exonic
1152755094 17:82083912-82083934 GGCTGGTGAGCCAGGGCGGCGGG + Intronic
1152915140 17:83030757-83030779 GGCCTCTGAACTGGGGCCTCAGG - Intronic
1153515278 18:5895739-5895761 GGCCGCGGGGCAGGGGGCGCGGG + Intronic
1153904544 18:9649788-9649810 TGCCCCTGAGCCTGGGCAGCAGG - Intergenic
1154274695 18:12948499-12948521 GGCCGCGCTGCCGGGGCTGCGGG + Intronic
1155507829 18:26549170-26549192 GCCCGCTGCGCCCTGGCCGCGGG - Exonic
1157095145 18:44680366-44680388 GCCAGCGGAGCCGGAGCCGCCGG + Intronic
1157473692 18:48008323-48008345 GGGCGCTGGGCCGGGGGCGGGGG + Intergenic
1160496723 18:79380376-79380398 AGCCGCTCAGCAGGGGCGGCAGG + Intergenic
1160701129 19:507920-507942 GGCCCCTGCGCCGGCGCTGCGGG - Intronic
1160719234 19:590155-590177 GGCTGCGGAGCCGGCCCCGCGGG - Exonic
1160726433 19:619772-619794 GGCGGGTGGGCCGGGGGCGCGGG + Intronic
1160766865 19:812681-812703 GGGCGCTGGGCCCGGGCAGCCGG - Exonic
1160903318 19:1440057-1440079 GGCGGCTGAACCGGGGCCTGCGG + Exonic
1160922264 19:1526545-1526567 GGCCGCTGACCAGGCCCCGCAGG - Exonic
1161009721 19:1954400-1954422 GCCCTCTGACCTGGGGCCGCAGG - Intronic
1161317846 19:3626595-3626617 GGCGGCGGAGCCGGGAGCGCAGG - Exonic
1162128447 19:8511650-8511672 GGCCGCTGCACCCGGGCCGCCGG - Exonic
1162445168 19:10718399-10718421 GGCCGGTGAGCGGGCGCGGCAGG + Exonic
1162809204 19:13154067-13154089 GGAGTCTGAGCCGGGGGCGCGGG + Exonic
1163275453 19:16281191-16281213 GGCCCCTGGGCTGGGGCCGAGGG + Intergenic
1163427108 19:17245776-17245798 GGCCGCTGGGCCGGCGCCTCTGG + Exonic
1166107701 19:40605502-40605524 GGACGCTGAGGCGGTGGCGCGGG + Exonic
1166528372 19:43527124-43527146 GGCAGCTGAGCCAGCGCGGCGGG - Exonic
1167017553 19:46850786-46850808 CGCCGCGGGACCGGGGCCGCTGG - Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167424606 19:49423519-49423541 GGCCGGGGGGCCGGGGACGCGGG + Intergenic
1167648918 19:50719351-50719373 AGCTGCGGGGCCGGGGCCGCGGG - Intronic
1167797545 19:51719640-51719662 GGCGGCGGCGCGGGGGCCGCTGG - Exonic
1168354517 19:55692896-55692918 GGGGGCTGAGGCGGGGCCCCAGG + Intronic
926018292 2:9473782-9473804 GGCCTCTGCGCCGGCGCCCCTGG + Intronic
926176961 2:10602167-10602189 GGCCTCTGAGGAGGGGCCACAGG - Intronic
927194571 2:20538768-20538790 TGCCCCTGAGCTGGGCCCGCTGG + Intergenic
927633339 2:24793308-24793330 GGCCTCTGGGGCGGAGCCGCAGG - Exonic
927990048 2:27441586-27441608 GGCGGCTGAGCTGGTGCAGCTGG + Exonic
930872706 2:56184476-56184498 GGCCGCTGGGTTGGGGCGGCGGG - Exonic
934176400 2:89582900-89582922 CGGGGCTGAGCCGGGGCCACAGG - Intergenic
934286710 2:91657261-91657283 CGGGGCTGAGCCGGGGCCACAGG - Intergenic
934476856 2:94599354-94599376 GGCAGCTGAGCAGGGCCCACTGG - Intronic
935137876 2:100322747-100322769 GCTCGCTGAGGCGGGGCCTCTGG - Intergenic
940640776 2:156342445-156342467 GGCCGCGGGGCCGAGTCCGCGGG - Intergenic
941367016 2:164621538-164621560 GGCCGGTGGGTGGGGGCCGCGGG + Exonic
941906114 2:170716866-170716888 GGCCGCAGAGGCGGGGAAGCGGG - Exonic
941986672 2:171517558-171517580 GGCGGCTGAACCGGGGCCTGCGG - Intergenic
942116651 2:172735561-172735583 GGCCTCTGAGGCGGGGCGGGAGG - Intronic
946339182 2:219057389-219057411 GGGCCCGGGGCCGGGGCCGCAGG - Intronic
947201429 2:227617826-227617848 GGCCTCTGGGCAGGGGCTGCAGG + Intronic
948393308 2:237627512-237627534 GGGCGCTGGGCCGGGGACGCGGG - Intergenic
948616760 2:239204289-239204311 GGCCCCTGTGCCCGGGCCACGGG + Intronic
948921754 2:241069167-241069189 GGCCACTGGGCAGGAGCCGCTGG + Intronic
1169487012 20:6042189-6042211 GGAGGCTGAGAAGGGGCCGCTGG + Exonic
1171123216 20:22582931-22582953 GGCGGCTCGGCCGGGGCGGCCGG - Exonic
1171481969 20:25460994-25461016 GGCAGCCGAGCAGGGGCCTCAGG - Intronic
1172320886 20:33994316-33994338 GGCCGGGGACCCGGGGCGGCGGG - Intronic
1173479916 20:43390428-43390450 GGCCTCTGAGGCGGGGGCGGTGG + Intergenic
1174204307 20:48827947-48827969 CGCCGCTGAGCCCGGCCCGCCGG - Intergenic
1174204337 20:48828008-48828030 GGCGGCTGGGCCGGGGGCGGAGG + Intergenic
1174263974 20:49318402-49318424 GGCCTGGGAGCGGGGGCCGCTGG + Intergenic
1174399377 20:50267708-50267730 GGCTGCTGAGCAGGGGCGGCAGG + Intergenic
1174804454 20:53593755-53593777 GGCCGAGGAGCCGGAGCCGCAGG - Exonic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1175517251 20:59577471-59577493 CGGAGCGGAGCCGGGGCCGCGGG - Intergenic
1175900958 20:62359758-62359780 AGCAGCTGAGCCTGGGCCCCCGG - Intronic
1176086378 20:63297306-63297328 GTCCCCTGAGCTGGGGCCCCTGG - Intronic
1176086437 20:63297459-63297481 GTCCCCTGAGCTGGGGCCCCTGG - Intronic
1176143179 20:63553991-63554013 GGCCCCTCAGTCGGGGACGCGGG + Exonic
1176159427 20:63640949-63640971 GTCCTCTGAGCCGGCGCCCCTGG - Exonic
1176381871 21:6117767-6117789 GGAGGCTGAGCCAGGGCGGCCGG - Intronic
1176733525 21:10522023-10522045 GGCCTAGGAGCCGGAGCCGCAGG + Intronic
1178334505 21:31731707-31731729 GGCGGCTGCTCCGGGCCCGCCGG + Exonic
1178914282 21:36698304-36698326 GGTCGCTGAGCCAGGGTCACAGG - Intergenic
1178992134 21:37365987-37366009 GGACGCTGCGCCGGGCCCGGCGG - Intronic
1179177634 21:39020798-39020820 GGACTCTGAGCAGGGGCCACAGG - Intergenic
1179186286 21:39087498-39087520 GGGGTCTGAGCCGGGGCAGCAGG + Intergenic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1179741601 21:43420472-43420494 GGAGGCTGAGCCAGGGCGGCCGG + Intronic
1179971486 21:44838442-44838464 GGTCGCTGAGCAGGGGCCTGGGG + Intergenic
1180085372 21:45505735-45505757 GGGTGCTGGGCAGGGGCCGCAGG - Intronic
1180163281 21:46007379-46007401 GGCCACGGAGCAGGGGCCGCAGG - Intergenic
1180180697 21:46117563-46117585 GGCTGCTGGGCTGGGGCTGCTGG - Intronic
1180560359 22:16610158-16610180 GGCCGAGGCGCCGGAGCCGCAGG - Intergenic
1180603551 22:17037611-17037633 GGCCTCTGAGCTGGGGCCTAGGG + Intergenic
1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG + Intronic
1181019246 22:20090146-20090168 GGGTGCTGACCCGGGGCCCCCGG + Exonic
1181778935 22:25178920-25178942 GTCCTCTGAGCCGGCGCCCCTGG - Intronic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183357273 22:37366563-37366585 GGCAGCTGAGCAGGGGCTCCTGG + Intergenic
1183468503 22:37992787-37992809 GGCTGCAGAGCCAGGGCCGATGG + Intronic
1183903239 22:41021813-41021835 GGGGGCTGGGCGGGGGCCGCAGG + Intergenic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184387001 22:44182074-44182096 AGCCTCTGAGCAGGGGCAGCCGG - Intronic
1184593857 22:45502814-45502836 CGCGGCGGAGGCGGGGCCGCGGG - Intronic
1184887468 22:47355232-47355254 GGTCGCTGTGCCGGGCCCCCTGG + Intergenic
1185383912 22:50522918-50522940 AGCAGGTGAGGCGGGGCCGCTGG + Exonic
950345519 3:12288443-12288465 GGGCGCGGAGCCGGGGACACGGG + Intronic
951078552 3:18425286-18425308 GGCGGATGAGCCGGCCCCGCTGG - Intronic
952902920 3:38121570-38121592 GGGCTCTGAGCCAGGGCCTCTGG - Intronic
954152038 3:48662599-48662621 GGCCGCCGTGGCGGGGCCTCGGG - Exonic
954967792 3:54626339-54626361 GGCGGCTGAACCGGGGCCTGCGG + Intronic
955407651 3:58635634-58635656 GGCCGGTGGGCGGGGGCGGCCGG - Intronic
956114468 3:65904483-65904505 GGCAGCAGAGGCCGGGCCGCAGG - Intronic
956726106 3:72157792-72157814 GGCTGCTGATCCTGGGCCTCTGG + Intergenic
961585118 3:127915664-127915686 GGGCGCCGACCCGGGGCCACCGG + Intronic
961698865 3:128726334-128726356 GGCCGCTGCGCTGGGGGCTCCGG - Exonic
965913627 3:173814079-173814101 AGCCCCTGAGCTGGGCCCGCAGG + Intronic
966808751 3:183825611-183825633 GGCCGCGGGGGCGGGGACGCTGG - Intergenic
966886529 3:184380389-184380411 GGGCTCTGGGCCGGCGCCGCGGG - Exonic
967876500 3:194271453-194271475 GGGGGCTGAGCCAGGGCGGCGGG - Intergenic
968511353 4:997291-997313 GCCCGCTGGGCTGGGGGCGCGGG - Intronic
968512662 4:1002481-1002503 GCTGGGTGAGCCGGGGCCGCTGG + Exonic
968522330 4:1039626-1039648 GGGTGCTGGGCCGGGGCCGCAGG + Intergenic
968691598 4:1992942-1992964 GGCCGCTGACCCTGCGCCCCGGG + Intronic
968815176 4:2818243-2818265 GGCCGCGGAGCTGGGGCCGGCGG + Exonic
972476925 4:39459150-39459172 CGCCGCTCACCCGGGGCCCCAGG - Exonic
973249675 4:48047920-48047942 GGCCCCTCAGCCTGGGCTGCAGG - Intergenic
973317716 4:48779594-48779616 GGCGGCGGAGCCGTGGTCGCCGG + Intronic
975395467 4:73869389-73869411 AGCCACAGAGCCCGGGCCGCAGG + Exonic
977323586 4:95548738-95548760 GGCGGCGGAGCCAGTGCCGCTGG + Exonic
979632815 4:122922543-122922565 AGCCACTGAGCTGGGGCCGCTGG - Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984167531 4:176320297-176320319 GGCTGCCGTGCCGGGGCCGCGGG + Intronic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
984823496 4:183905205-183905227 GGGCGCTGGGCCCGGGACGCGGG - Intronic
984823909 4:183906978-183907000 TGCCCCCGGGCCGGGGCCGCGGG + Intronic
985233695 4:187849732-187849754 GGCCGCTGGCATGGGGCCGCTGG - Intergenic
985446036 4:190021783-190021805 GCCCGCTCAAGCGGGGCCGCAGG - Intergenic
985451348 4:190065502-190065524 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
985452338 4:190068795-190068817 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
985453323 4:190072092-190072114 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985454313 4:190075385-190075407 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985455301 4:190078678-190078700 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985456289 4:190081978-190082000 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985457273 4:190085272-190085294 GCCCGCTCAAGCGGGGCCGCAGG + Intergenic
985458260 4:190088565-190088587 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985459249 4:190091865-190091887 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985463501 4:190174634-190174656 GCCCGCTCAAGCGGGGCCGCAGG + Exonic
985537586 5:473609-473631 GGCCGCTGTCCCGGGACCCCCGG - Intronic
986330815 5:6714632-6714654 GGCCGCGGCGCCTGGGCCCCGGG - Exonic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
989011247 5:36875907-36875929 GGTGGCTGAGTCGGGGCCGGCGG + Intergenic
989146781 5:38257948-38257970 GGCCGCTCAGACTGGGACGCCGG - Intergenic
991216839 5:64165767-64165789 GGCCGCGGGGTCGGGGCTGCAGG + Intergenic
992716308 5:79514224-79514246 CGCCGCGGAGCCGCGGCCGGGGG + Intergenic
995047905 5:107671098-107671120 CGACGCTGAGCCGGGCCCGGCGG - Intergenic
997282147 5:132656135-132656157 TGCCGCTCGGCCGGGCCCGCGGG + Intergenic
997461841 5:134058256-134058278 GGCTGCTGACCTGGGTCCGCTGG - Intergenic
997692350 5:135835283-135835305 GGCTGCTGATCCCGGGGCGCAGG + Intronic
997704111 5:135930633-135930655 GGCGGCCGGGCCCGGGCCGCGGG - Intronic
998349099 5:141489351-141489373 GGAGTCTGAGCCGGGGACGCTGG + Exonic
999248319 5:150167100-150167122 GGCCGCGGGGCCCGGGCCGTAGG - Exonic
1000463408 5:161548177-161548199 GGCCGCCTCGCCGTGGCCGCCGG + Intronic
1001515264 5:172350892-172350914 GGCCCCAGAGCTGGGGCTGCTGG - Intronic
1001723110 5:173872870-173872892 AGCCACTGAGCCAGGGCCTCAGG + Intergenic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002296126 5:178232341-178232363 GGCCGCTGCCCCGGCCCCGCTGG - Intronic
1002444414 5:179280332-179280354 GGACGCTGAGCCAGGGGCCCTGG + Intronic
1002896059 6:1381266-1381288 GGCGTCTCAGCCGGGGCTGCAGG - Intergenic
1002927249 6:1611577-1611599 GGCGGCGGCGCGGGGGCCGCGGG + Exonic
1003108207 6:3231373-3231395 GGCAGCTCCGCCGGGGCCGCTGG - Intronic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003645330 6:7909969-7909991 GGGCGCTGGGCAGGGACCGCGGG + Intronic
1004043951 6:12009163-12009185 GGGCGGAGGGCCGGGGCCGCGGG + Intronic
1005832391 6:29681139-29681161 GGCCGCGGCGCCGGGACTGCGGG - Intergenic
1006642648 6:35496929-35496951 GGCCGCTCCGCCGGGCCCGAGGG + Exonic
1007499039 6:42281265-42281287 GGCCCCGGAGCCTGGGCTGCAGG + Intronic
1010032871 6:71288743-71288765 GGCGGCGGTCCCGGGGCCGCCGG + Intergenic
1011277442 6:85643768-85643790 GGCCGCGGAGCCGGGGGCGGGGG - Intronic
1014569838 6:122996028-122996050 GGCTGCTGAGCGGGCGTCGCCGG - Exonic
1015149274 6:130020001-130020023 GGCGGCCGCGCCGGGGCGGCGGG + Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1018945826 6:168346134-168346156 GGGGGCTGAGCCTGGGCAGCAGG - Intergenic
1019048924 6:169168479-169168501 GCCTGCTGACCTGGGGCCGCAGG + Intergenic
1019166186 6:170098952-170098974 GACGGCTGTGCCGGGGCGGCAGG - Intergenic
1019279524 7:192917-192939 GTCCGCGGAGCCGGGCGCGCGGG - Intergenic
1019666629 7:2255127-2255149 GGCAGCTGAGCTTGGGCCTCAGG + Exonic
1019676222 7:2314248-2314270 GGCGGCTGAGCCCCGTCCGCCGG + Intronic
1019789094 7:2998832-2998854 GGCAGCTCAGCTGGGGCCGCAGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020771704 7:12403744-12403766 CGTCGCAGAGCCCGGGCCGCGGG + Exonic
1023873765 7:44276159-44276181 GGCCCCTGAGCCGGGGAGGAGGG + Intronic
1024595997 7:50938114-50938136 GGCCACTGAGCCTGGGCCCCAGG - Intergenic
1026995413 7:74612724-74612746 GCCTGCTGGGCCTGGGCCGCTGG - Intergenic
1027189030 7:75987342-75987364 GGCAGGTGAGCCGGGGTCCCTGG - Exonic
1029655713 7:101923100-101923122 GGCCAGTGAGCCGGGGCTGCAGG - Intronic
1030348101 7:108455835-108455857 AGCCGCCGTGCCGGGCCCGCAGG + Intronic
1034264126 7:149773118-149773140 GGCCGCTCCGCCCGCGCCGCGGG + Exonic
1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG + Intronic
1034546127 7:151790604-151790626 GGCCGCAGAGTCTGTGCCGCTGG + Intronic
1035123059 7:156585189-156585211 GTCAGCTGAGCCGGGGCTGCAGG + Intergenic
1035267712 7:157700787-157700809 GGCCGCTGACCAGGGGCTCCTGG - Intronic
1035637360 8:1156628-1156650 GGGCGCTGAGCCGGGGCGCTGGG - Intergenic
1036768722 8:11564703-11564725 GGCGGTTGAGCGGGGCCCGCAGG + Intergenic
1036847683 8:12181024-12181046 GGCTGCTGAGCAGGGGCCAAGGG - Intergenic
1036869051 8:12423339-12423361 GGCTGCTGAGCAGGGGCCAAGGG - Intergenic
1038338157 8:26661936-26661958 GGCCGCTTCCCTGGGGCCGCTGG - Intergenic
1038422743 8:27443812-27443834 GAACGCTGAGCCAGGCCCGCGGG - Intronic
1038447518 8:27614451-27614473 GGCGGTTGCGCCGGGGCCCCTGG + Intronic
1038447519 8:27614461-27614483 GGCAGCTGAGCCAGGGGCCCCGG - Intronic
1038554071 8:28494365-28494387 GGCCCCTGGGCCGGGGCAGCGGG + Intronic
1039608139 8:38899915-38899937 GGCCGATGAGCCAGGACCGAGGG - Intergenic
1041124455 8:54621335-54621357 GGCTGCTGAGCCAGGGCCGCGGG - Exonic
1041910749 8:63086086-63086108 GGCCGCAGAGGCGGGGCCGAGGG - Intergenic
1043844959 8:85152942-85152964 GGCCGCGGAGCAGGGGCTGCCGG - Intergenic
1049104448 8:140603195-140603217 GTCTGCTGAGCCGGGTCCACAGG - Intronic
1049109691 8:140635366-140635388 GGCCGCGGGGTCGGGGCGGCGGG - Intronic
1049180898 8:141221650-141221672 GCACCCTGAGCTGGGGCCGCCGG - Exonic
1049405685 8:142450963-142450985 CGCCGGTGAGCAGAGGCCGCCGG + Intronic
1049429165 8:142551207-142551229 GGCCGCTGAGCCAAGGCTGGTGG + Intergenic
1049689832 8:143953587-143953609 GGTCGCTGAGCCAGAGCCGCAGG - Intronic
1049718247 8:144103803-144103825 GGCCGCTGAGCCCCCTCCGCCGG + Exonic
1049766638 8:144358211-144358233 GGCCGCGGCGCTGGGGCCCCGGG + Exonic
1050537789 9:6645455-6645477 GGGGGCTGCGCCTGGGCCGCGGG - Exonic
1052853172 9:33390555-33390577 GGCAGCTGAGCAGGGCCCACTGG + Intronic
1053055189 9:34989757-34989779 GGCGGCGGAGCCGGAGCCGGGGG + Exonic
1053240099 9:36487906-36487928 CGCCCCTGAGGCGCGGCCGCGGG + Intergenic
1053681210 9:40486723-40486745 GGCAGCTGAGCAGGGCCCACTGG + Intergenic
1054282504 9:63138211-63138233 GGCAGCTGAGCAGGGCCCACTGG - Intergenic
1054294297 9:63322239-63322261 GGCAGCTGAGCAGGGCCCACTGG + Intergenic
1054392319 9:64626727-64626749 GGCAGCTGAGCAGGGCCCACTGG + Intergenic
1054426967 9:65131937-65131959 GGCAGCTGAGCAGGGCCCACTGG + Intergenic
1054503408 9:65889603-65889625 GGCAGCTGAGCAGGGCCCACTGG - Intronic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1057173013 9:92975158-92975180 CCCCGCAGAGCCGGGGCCTCTGG + Intronic
1057259744 9:93576934-93576956 GGGCGCGCAGCCGGGGGCGCGGG - Intronic
1057546319 9:96022059-96022081 GGCCACTTGGCCGGGGGCGCCGG - Intergenic
1057600163 9:96450574-96450596 GGCCGCTGAGCGACGGGCGCCGG - Exonic
1059119762 9:111631432-111631454 GGCTGGGGAGCCGGGGCTGCCGG + Exonic
1060594238 9:124838963-124838985 AGCCGCTGGCCCGGGGCCGGTGG + Intergenic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061015975 9:127980933-127980955 GGCTGCAGCGTCGGGGCCGCAGG - Intergenic
1061680920 9:132242103-132242125 GGCCGCTGAGCCCCGCCCGGAGG + Exonic
1061851453 9:133418275-133418297 GGCAGCTGAGCTGGGGGCACTGG + Intronic
1061974761 9:134062508-134062530 GGCCGCTCACCCAGGGCCGTGGG - Intronic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062363981 9:136200199-136200221 GGCCACTGGGCCAGAGCCGCTGG + Intronic
1062435747 9:136545941-136545963 GGGCGCGGAGCCGGGCCCGGGGG - Intergenic
1062472382 9:136712297-136712319 GGAGGCGGAGCCGGGGCCGGGGG - Intergenic
1062476013 9:136727950-136727972 GGCCGCGGAGGAGGCGCCGCTGG - Intergenic
1185605681 X:1366522-1366544 GCCCGGTGAGCCGGGTGCGCGGG + Intronic
1185761816 X:2694150-2694172 GGCCGCTGTGCCGTTGCCCCGGG - Intronic
1186466045 X:9785735-9785757 GGCCGCTGCCCCGGGGCAGAGGG - Intronic
1186537269 X:10363227-10363249 GGCCTCTGACCATGGGCCGCTGG + Intergenic
1187181460 X:16946988-16947010 GCGCGCTGTGCCGGCGCCGCGGG + Exonic
1191250277 X:58256907-58256929 AGCCACTGAGCTGGGCCCGCAGG + Intergenic
1191251975 X:58264121-58264143 AGCCCCTGCGCCGGGCCCGCGGG + Intergenic
1194721530 X:97346227-97346249 GGCCCCTGATCTGGGGCCCCAGG + Intronic
1198100034 X:133415288-133415310 GGCCGGCGAGGCGGGGACGCGGG + Exonic