ID: 1020011823

View in Genome Browser
Species Human (GRCh38)
Location 7:4809410-4809432
Sequence TTCCTGTGTGCACGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020011823_1020011827 20 Left 1020011823 7:4809410-4809432 CCTCCTTTCCGTGCACACAGGAA 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1020011827 7:4809453-4809475 AAGCCAACGAATTTCCCCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020011823 Original CRISPR TTCCTGTGTGCACGGAAAGG AGG (reversed) Intronic