ID: 1020013537

View in Genome Browser
Species Human (GRCh38)
Location 7:4818638-4818660
Sequence CCCACAGCGAGTGCCGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020013527_1020013537 17 Left 1020013527 7:4818598-4818620 CCTCCAGGCCTGTGGAGACACAC 0: 1
1: 0
2: 1
3: 33
4: 275
Right 1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1020013531_1020013537 9 Left 1020013531 7:4818606-4818628 CCTGTGGAGACACACAAGGTGGC 0: 1
1: 1
2: 1
3: 20
4: 145
Right 1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1020013526_1020013537 24 Left 1020013526 7:4818591-4818613 CCAGAAGCCTCCAGGCCTGTGGA 0: 1
1: 0
2: 4
3: 37
4: 436
Right 1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1020013524_1020013537 25 Left 1020013524 7:4818590-4818612 CCCAGAAGCCTCCAGGCCTGTGG 0: 1
1: 0
2: 3
3: 44
4: 403
Right 1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1020013528_1020013537 14 Left 1020013528 7:4818601-4818623 CCAGGCCTGTGGAGACACACAAG 0: 1
1: 0
2: 2
3: 23
4: 221
Right 1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020013537 Original CRISPR CCCACAGCGAGTGCCGGCAA AGG Intronic
902410776 1:16210318-16210340 CCCACAGCGAGGCCAGGCTAGGG - Intronic
902537749 1:17131045-17131067 CCCACAGAGAGTACCCACAAGGG + Intergenic
902773793 1:18661480-18661502 CCCAGAGCAAGTGCTGGGAAAGG - Intronic
904262842 1:29300022-29300044 CACACAGCGAGCACCTGCAAGGG - Intronic
908027186 1:59965544-59965566 CACACAGCAAGTGCAGGAAAGGG - Intergenic
909482733 1:76142973-76142995 CCCACAGCCAGAACCGGCAGAGG + Intronic
920854002 1:209648937-209648959 CCCACAGGGAGTCCTGGCTAGGG + Intronic
1064058902 10:12120808-12120830 CCTACAGCGGGTACTGGCAAAGG - Exonic
1069461675 10:68600536-68600558 CCCACAAAGAGTGCAGCCAATGG - Intronic
1075446875 10:122519316-122519338 CCCAGAGTGAGTCCCGACAAGGG - Intergenic
1081668998 11:44933006-44933028 CCCACAGGTGGTGCCGCCAATGG - Exonic
1085696863 11:78712525-78712547 CCCGCAGCGAGTGTCATCAAAGG + Exonic
1090807595 11:130212072-130212094 CCCGCAGAGAGTCCCGGAAAGGG - Intergenic
1092395570 12:8122491-8122513 CACTCTGAGAGTGCCGGCAAAGG - Intergenic
1092989167 12:13878259-13878281 CCCACAGTGAGTGGCAGAAAGGG - Intronic
1094025989 12:25959626-25959648 CCCAAAGGGACTGGCGGCAAAGG - Intronic
1101842485 12:108338205-108338227 TCAACAGAGAGTGCCGGCAAAGG + Intronic
1104994982 12:132648746-132648768 GGCAGAGCGAGTGCCGGGAATGG - Intronic
1113847802 13:113402570-113402592 CCCACAGGGACTGCAGGGAAGGG + Intergenic
1118694187 14:68368299-68368321 CCCACAGCCAGTGCATGCTAAGG + Intronic
1122982903 14:105199574-105199596 CCCACAGCCAGGGACAGCAAGGG - Intergenic
1129602743 15:77009820-77009842 CCCACAGCGAGTCCAGGCAGTGG - Intronic
1132074612 15:98809755-98809777 CCCTCAGTGAGTGCCTGCAGGGG + Intronic
1134068401 16:11245098-11245120 CCCACATCGAGTGCAGATAATGG - Intergenic
1138763120 16:59567730-59567752 CCCACAGGGAGTCCCGGCAGGGG - Intergenic
1143446727 17:7014365-7014387 CCCGCAGAGGGCGCCGGCAAGGG - Exonic
1144180354 17:12745825-12745847 CCCAAAGTGATTGCCTGCAAGGG - Intronic
1152612338 17:81322042-81322064 GCCACAGGGAGTGCTGGGAAAGG - Intronic
1157792581 18:50545938-50545960 CCCTCAGCCAGTGAGGGCAAAGG - Intergenic
1159102291 18:63970400-63970422 CCCACCGCGAGACCCGGCGAAGG + Intronic
1166945302 19:46392404-46392426 CCCACAGCAACTGCCGTCACGGG - Intronic
926268782 2:11348872-11348894 CCCATAGCTAGTGCTGGAAAAGG + Intergenic
936065239 2:109326492-109326514 GCAACAGCAAGTGTCGGCAAGGG - Intronic
937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG + Intronic
939132675 2:138256486-138256508 TTCACAGCGAGTGCCTACAATGG + Intergenic
947715943 2:232338883-232338905 CCCACAGCACCTGCCGGCCAGGG + Intronic
947734966 2:232449625-232449647 CCCACAGCACCTGCCGGCCAGGG + Intergenic
948553929 2:238794583-238794605 CCCACAGGGAGAGCCGGCCATGG + Intergenic
948553944 2:238794647-238794669 CCCACAGGGAGAGCCGGCCATGG + Intergenic
948553974 2:238794777-238794799 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948554003 2:238794907-238794929 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948554059 2:238795163-238795185 CCCACAGGGAGAGCCGGCCATGG + Intergenic
948554074 2:238795227-238795249 CCCACAGGGAGAGCCGGCCGTGG + Intergenic
1172713013 20:36941695-36941717 TCAACAGAGAGTGCAGGCAAAGG + Intronic
1176101120 20:63365037-63365059 CCCACAGCGCGTCCCAGCACTGG - Intronic
1180125710 21:45788638-45788660 CCCACAGTGAGTGAGGTCAATGG - Intronic
1180694767 22:17744611-17744633 CCCACAGGGAGTGGTGGCACTGG + Intronic
1181314714 22:21963799-21963821 CCCACAGCCAGGGCAGGCAGAGG + Intronic
1183335024 22:37241502-37241524 CCCACAGGAAGTGCCTGAAAGGG + Intronic
1184092987 22:42302062-42302084 CCCAGAGCAAGAGCCGGCAAAGG + Intronic
950200637 3:11040536-11040558 CCCAAAGCCAGTGCCTGCGATGG - Intergenic
955415739 3:58689372-58689394 CCCACAGCATGTTCAGGCAACGG - Intergenic
957459459 3:80497747-80497769 CCCACAGCGGGTGCTGGGAGAGG + Intergenic
959398383 3:105869113-105869135 CCGACAGCGGGTGCAGCCAATGG + Intronic
961296136 3:125886207-125886229 CCCACAGCAGGAGCCGGGAATGG - Intergenic
961629071 3:128283107-128283129 CCCAAAGCCAGTGCCTGAAAGGG - Intronic
961889662 3:130119967-130119989 CCCACAGCAGGAGCCGGGAATGG + Intergenic
985591525 5:767879-767901 CCCACAGCGAGAGCTGGCCCTGG - Intergenic
985609441 5:878838-878860 CCCACAGCGAGAGCTGGCCCTGG - Intronic
999319930 5:150608055-150608077 ACCACAGCGAGTGCCTCGAAAGG - Intronic
999491006 5:152051939-152051961 GCCACAGCAAGTGCCGCCCAAGG - Intergenic
1015163503 6:130178360-130178382 CCCACAGTGAGTGCGGGGAAGGG + Intronic
1019050435 6:169179037-169179059 CCCCCACCGAGTGCCAGCAACGG - Intergenic
1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG + Intronic
1020200683 7:6077463-6077485 CCCACAGTGAGGGCTGGCTAGGG - Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1037766094 8:21773225-21773247 CCCACAGGCAGTGCCAGCATGGG + Intronic
1047435792 8:124834668-124834690 CCCACTGCGAGGGCCTGCCATGG - Intergenic
1052049765 9:23831433-23831455 CACAGAGCAAGTGCCGGCACCGG + Intergenic
1062657226 9:137610361-137610383 CCCACAGAGGATGCCGGAAAGGG - Intronic
1185453636 X:296475-296497 TCCACAGCCAGAGACGGCAAAGG - Intronic
1191252657 X:58266916-58266938 CCCACACCCAGCCCCGGCAAAGG + Intergenic
1196013761 X:110915800-110915822 CCCACAGCAAATGCCATCAAAGG + Intergenic
1200259018 X:154602224-154602246 CCCGCAGGGAGGGCCGGCCAGGG + Intergenic