ID: 1020013679

View in Genome Browser
Species Human (GRCh38)
Location 7:4819372-4819394
Sequence CGTCTCCGGGGGTTTAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020013679_1020013690 5 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013690 7:4819400-4819422 CCCTGTGGTACCAGGGCTGGTGG No data
1020013679_1020013692 6 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013692 7:4819401-4819423 CCTGTGGTACCAGGGCTGGTGGG No data
1020013679_1020013694 17 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013694 7:4819412-4819434 AGGGCTGGTGGGCATTTCTGAGG No data
1020013679_1020013686 -2 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013686 7:4819393-4819415 CGCCTCTCCCTGTGGTACCAGGG 0: 1
1: 0
2: 1
3: 15
4: 115
1020013679_1020013685 -3 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013685 7:4819392-4819414 ACGCCTCTCCCTGTGGTACCAGG No data
1020013679_1020013688 2 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013688 7:4819397-4819419 TCTCCCTGTGGTACCAGGGCTGG No data
1020013679_1020013683 -10 Left 1020013679 7:4819372-4819394 CCATTTCTAAACCCCCGGAGACG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1020013683 7:4819385-4819407 CCCGGAGACGCCTCTCCCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020013679 Original CRISPR CGTCTCCGGGGGTTTAGAAA TGG (reversed) Intronic
903659733 1:24969744-24969766 CCTCTCCGGGGGTGGAGAATGGG + Intergenic
905941145 1:41864392-41864414 TCTTTCCGGGGCTTTAGAAATGG - Intronic
909377326 1:74954132-74954154 CAGCTCAGGGGGTTTAGATAGGG - Intergenic
915098827 1:153484108-153484130 CGTATCTGGGGGTTCAGAAAAGG - Intergenic
916193441 1:162200592-162200614 CTTCTCTGAGGGTTTGGAAAGGG + Intronic
917566860 1:176221263-176221285 CCTCTCTGGGGGTTTAGATCAGG + Intergenic
923300679 1:232637736-232637758 TGTGTCCGGTGGTTTAGAACAGG - Intergenic
1063053360 10:2477017-2477039 CGTCTCTGGGGGTGTTGAAAAGG + Intergenic
1068722021 10:60255992-60256014 GGTCTCCGGGGGCTCAGAAGGGG + Intronic
1089123787 11:116162016-116162038 CGTCTCCTGGGGTTGAGGTAAGG - Intergenic
1092460341 12:8680639-8680661 CCTCTCCGGGGGTTTGGATGGGG + Intergenic
1101996831 12:109531697-109531719 GGTCTCCGGGGATTTAGGATGGG + Intronic
1112673729 13:101672942-101672964 ATTCTACGCGGGTTTAGAAAAGG - Intronic
1130926314 15:88388281-88388303 CCTCCCCGGGGTTATAGAAAGGG + Intergenic
1138577287 16:57916080-57916102 CGTCTGCGGGGTTTCAGAAGGGG - Intronic
1139262210 16:65605338-65605360 CCACTCAGGGGTTTTAGAAAGGG - Intergenic
1141090462 16:81126840-81126862 GGTCTCCTGGGGTTAAGGAAAGG - Intergenic
1147882419 17:43662725-43662747 CGCCTCTGGGGGATGAGAAAGGG - Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1164775559 19:30850868-30850890 CTGCTCCTGGGGTTTTGAAAAGG - Intergenic
1167833701 19:52048785-52048807 CGTCTCTGGAGGTTTAGAGGGGG - Intronic
1168074068 19:53969639-53969661 GGGCTCCAGGGGTGTAGAAACGG + Intronic
930002552 2:46870856-46870878 CGCCTCCTGGGGTTGAGAATGGG - Intergenic
930342438 2:50133961-50133983 CTGCTCCTGGGGTTTAGAGAAGG - Intronic
936582585 2:113716305-113716327 CTTCTCCTGGGGTAGAGAAAAGG - Intronic
943567591 2:189534698-189534720 CCTCTTCAGGGGCTTAGAAAAGG + Intergenic
1173336651 20:42117453-42117475 CTACTCCTGGGGCTTAGAAATGG - Intronic
1173448347 20:43139803-43139825 CTTCTCCAGGGATTTAGAAGTGG + Intronic
1177510111 21:22075676-22075698 CCTCTCCTGGGGTCTAGATAGGG + Intergenic
952087055 3:29836535-29836557 CGTTACCAGGGGTATAGAAATGG + Intronic
953526901 3:43698844-43698866 CCTCTATGGGGGTTGAGAAAAGG - Intronic
957532084 3:81453351-81453373 GGTCTCAGAGGGTTTAGACAAGG + Intergenic
959359283 3:105368306-105368328 CGTCCCCGAGGGTGTGGAAAGGG - Intronic
967142643 3:186574350-186574372 AGTCTTTGGGGGTTTTGAAATGG + Intronic
972329335 4:38049826-38049848 GGTCCCCGGGGGTTTCGCAAAGG + Exonic
995936038 5:117515665-117515687 TGTCTCCAGGTGTCTAGAAAAGG + Intergenic
1012635003 6:101526903-101526925 CCTCTCCGGGGGTTCAGAGGAGG + Intronic
1018600310 6:165531123-165531145 CTCCTCTGGGGGTTTGGAAAGGG - Intronic
1018600410 6:165532512-165532534 CTCCTCTGGGGGTTTGGAAAGGG + Intronic
1020013679 7:4819372-4819394 CGTCTCCGGGGGTTTAGAAATGG - Intronic
1026847268 7:73705220-73705242 CGTCTCTGGGGAGGTAGAAAGGG + Exonic
1033669651 7:143478809-143478831 CTTTTCCGGGGGTCTAGATAAGG - Intergenic
1040812392 8:51469610-51469632 CCTCTCCAGGGGAGTAGAAAAGG + Intronic
1047682333 8:127266741-127266763 GGTCACTGGAGGTTTAGAAAAGG + Intergenic
1058925001 9:109654888-109654910 CGTCTCTTGGGAATTAGAAAAGG + Intronic
1185866618 X:3629950-3629972 GGTCTCCAGGGGTCAAGAAATGG - Intronic
1196274940 X:113755827-113755849 CTTCTCAGGGGGATTAGCAAAGG - Intergenic