ID: 1020014069

View in Genome Browser
Species Human (GRCh38)
Location 7:4820865-4820887
Sequence GTGGTGAGAGGGAGGTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1365
Summary {0: 1, 1: 1, 2: 4, 3: 109, 4: 1250}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020014069_1020014086 20 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014086 7:4820908-4820930 AAACCTGCCCCTAAGGCATGGGG No data
1020014069_1020014090 23 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014090 7:4820911-4820933 CCTGCCCCTAAGGCATGGGGGGG 0: 1
1: 0
2: 0
3: 14
4: 170
1020014069_1020014083 13 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014083 7:4820901-4820923 TCTCAGGAAACCTGCCCCTAAGG No data
1020014069_1020014085 19 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014085 7:4820907-4820929 GAAACCTGCCCCTAAGGCATGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1020014069_1020014084 18 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014084 7:4820906-4820928 GGAAACCTGCCCCTAAGGCATGG No data
1020014069_1020014087 21 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014087 7:4820909-4820931 AACCTGCCCCTAAGGCATGGGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1020014069_1020014078 -3 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014078 7:4820885-4820907 CACGGAGAGCCCCTCCTCTCAGG No data
1020014069_1020014088 22 Left 1020014069 7:4820865-4820887 CCCCGCCACCTCCCTCTCACCAC 0: 1
1: 1
2: 4
3: 109
4: 1250
Right 1020014088 7:4820910-4820932 ACCTGCCCCTAAGGCATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020014069 Original CRISPR GTGGTGAGAGGGAGGTGGCG GGG (reversed) Intronic
900090784 1:919553-919575 GTGCTGAGAGTGAGCTGACGTGG + Intergenic
900154944 1:1200207-1200229 AGGGGGAGAGGGAGGTGGGGGGG - Intergenic
900159663 1:1217474-1217496 GTGGTGCGTGGGGGGCGGCGCGG + Exonic
900172186 1:1274439-1274461 GGGGTCAGAGAGAGGTGGAGAGG - Intergenic
900461307 1:2803273-2803295 GTGCGGATTGGGAGGTGGCGTGG - Intergenic
900875835 1:5341884-5341906 GAGGAGAGAGGGAAGTGGCCTGG - Intergenic
901066768 1:6497983-6498005 TTGGCACGAGGGAGGTGGCGGGG - Intronic
901100696 1:6716286-6716308 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
901224147 1:7601987-7602009 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
901324957 1:8360444-8360466 GGGGTGGGAGGCAGGGGGCGGGG + Exonic
901417935 1:9129661-9129683 GTGGTGTGAGGGCGTGGGCGGGG - Intergenic
901746033 1:11374316-11374338 GTGGTGAGTGGTATGTGGTGTGG + Intergenic
901790059 1:11649248-11649270 GTGGGGGGCGGGAGGTGGGGTGG + Intronic
901850048 1:12009212-12009234 GTGGGGAGAGGGAGAGGGAGCGG + Intronic
901855635 1:12042682-12042704 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
902014968 1:13299426-13299448 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
902062429 1:13657375-13657397 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
902153217 1:14461695-14461717 GTGGTGACTGGCAGGTGGTGTGG + Intergenic
902544962 1:17184369-17184391 GTGGGGACAGGGAGGAGGGGTGG + Intergenic
903081180 1:20814778-20814800 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
903100181 1:21023259-21023281 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
903103229 1:21052564-21052586 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
903325843 1:22568077-22568099 ATGGAGAGAGGCAGGGGGCGGGG + Intronic
903331554 1:22599596-22599618 GTGGAGAGAGGGAGGGAGGGAGG + Intronic
903357430 1:22756567-22756589 GAGGTGTGGGGGAAGTGGCGGGG + Intronic
903400032 1:23036450-23036472 GTGGTGAGGGGGCGGGGGAGGGG - Intronic
903519249 1:23934974-23934996 GTGGGGAGGGGGAGGGGGAGGGG - Intergenic
903663411 1:24992558-24992580 CTGGACAGAGGGAGGTGCCGGGG + Intergenic
903748279 1:25603243-25603265 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
903758909 1:25684190-25684212 GGGGAGAGAGGCAGGTGGCTGGG - Intronic
903773538 1:25778847-25778869 GTGGTGAGTGGTGGGTGGGGAGG - Intronic
903795024 1:25922429-25922451 GGTGTGAGAGGGAGTTGGCGGGG + Intergenic
903879957 1:26501448-26501470 GTGGAGAGAGGGAGTCGTCGCGG - Intergenic
903907223 1:26695976-26695998 GAGGCGAGGGGGAGGGGGCGGGG - Intergenic
903993531 1:27290045-27290067 GTGGGGAGGGGGAGGGGGAGAGG + Intronic
904077164 1:27852156-27852178 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
904211637 1:28889711-28889733 GTGGTGGGAGTGAGGAGGGGAGG + Intronic
904471710 1:30740400-30740422 GTGGGGAGTGGGGGGTGGGGGGG - Intronic
904684078 1:32248252-32248274 GAGGTGAGAGGGGGCTGGGGAGG + Intronic
905018416 1:34792892-34792914 CTGGAGAGAGGGCGGGGGCGGGG - Intronic
905257712 1:36695676-36695698 GTGGTGGGAGTGGGGTGTCGTGG - Intergenic
905515364 1:38558502-38558524 GAGGTGAGAGGGAGAGGGGGAGG - Intergenic
905680691 1:39869086-39869108 ATGGGGAGAGGGAGGGGGAGGGG - Intronic
905686798 1:39914028-39914050 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
905753443 1:40486481-40486503 GTGGTGGGAGGGAGGGAGGGAGG - Intronic
906298663 1:44665068-44665090 GTGGTGAGAAGGGGTTGGGGAGG - Intronic
906427024 1:45723977-45723999 GTGGAGAGAGGGAGAGGGAGGGG - Intronic
906956649 1:50380996-50381018 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
907044223 1:51289889-51289911 GTGGTGAGTGGGGGTTGGCTAGG + Intronic
907089813 1:51712408-51712430 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
907216820 1:52870873-52870895 GTGGGGAGGGGGAGGGGGAGAGG + Intronic
907866589 1:58405075-58405097 GTGGAGAGAGGGAGGTGGCGGGG - Intronic
908032005 1:60010923-60010945 GTGGTGAGAGGCCAGTGGCACGG - Intronic
908108861 1:60874903-60874925 GAGGCCAGAGGGAGGGGGCGGGG - Intronic
908445978 1:64200460-64200482 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
908467679 1:64414232-64414254 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
908580593 1:65512185-65512207 GTAGTGAGTGGGAGGTGTCTGGG - Intronic
909179246 1:72400138-72400160 GTGAAGAAAGGGAGGTGCCGTGG - Intergenic
909708756 1:78619474-78619496 GTGGGGCTAGGGAGGTGACGAGG - Intergenic
909945928 1:81663042-81663064 GGGGTGGGAGGGAGGGGTCGGGG - Intronic
910106645 1:83638461-83638483 GTGGTGGGAAGAAGGTGGGGAGG - Intergenic
910343606 1:86215121-86215143 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
911220524 1:95240712-95240734 GTGGGGAGAGGCAGGCGGCGAGG + Intronic
911602228 1:99857829-99857851 GTGGGGAGGGGGAGGGGGAGGGG + Intronic
912316806 1:108675070-108675092 GTGGGGAGAGGGAGACGGAGAGG - Intergenic
912415059 1:109502467-109502489 GTGGTTTGGGGGAGGTGGTGAGG + Intronic
912432934 1:109639070-109639092 GTAGAGAGAGGGAGGCAGCGAGG - Intergenic
912503182 1:110136074-110136096 GTGAGGAGAAGGAGGTGGCCTGG - Intergenic
912542875 1:110430326-110430348 GTGGTGTTAGGCAGGTGGGGAGG - Intergenic
912709085 1:111937095-111937117 GTGGGGAGAGGGAGTTGTCTGGG + Intronic
913017834 1:114757482-114757504 GGGGCGAGGGGGTGGTGGCGCGG - Intronic
913022976 1:114805343-114805365 GTGGGGAGAGGGAGAGGGAGGGG + Intergenic
913306395 1:117431186-117431208 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
914231703 1:145767991-145768013 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
914780408 1:150780865-150780887 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
914787774 1:150850248-150850270 GTGGGGAGAGGGAGATGGAGAGG - Intronic
914887832 1:151599584-151599606 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
914894014 1:151652203-151652225 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
914937548 1:151993854-151993876 GTGGGTAGAGGGAGGCGGCGCGG + Exonic
914960065 1:152197236-152197258 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
915111244 1:153565776-153565798 GTGGGAAGTGGGAGGTGTCGTGG + Exonic
915208215 1:154286903-154286925 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
915456390 1:156043688-156043710 GTGGGGAGAGGGGGCTGGAGAGG - Intronic
915487731 1:156233726-156233748 CTGGTGAGAGTGGGGTGGGGAGG + Exonic
915526018 1:156476769-156476791 GAGGTGAGAGAGAAGTGGTGGGG - Intronic
915781400 1:158554670-158554692 TTGGGAAGAGGAAGGTGGCGAGG + Intergenic
916087661 1:161282399-161282421 GTGGGGAGAGGGAGAGGGAGGGG + Intronic
916429392 1:164712612-164712634 GGGGTCAGAGTGAGGTGGAGGGG + Intronic
916800188 1:168208623-168208645 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
916835854 1:168544054-168544076 GTGGTGAGAGGGGGCTTTCGAGG + Intergenic
916838614 1:168576526-168576548 GTGGTGAGAGGGGGCTTTCGAGG - Exonic
917006009 1:170418235-170418257 GTGGGGAGAGGGAGACGGAGAGG - Intergenic
917126822 1:171694661-171694683 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
917206013 1:172571964-172571986 GTAATGGGAGGGAGGTGGGGGGG + Intronic
917304436 1:173612574-173612596 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
917553145 1:176057318-176057340 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
917583311 1:176397586-176397608 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
917591463 1:176480750-176480772 GTGGGGAGAGGGAGAAGGGGTGG - Intronic
917889313 1:179419626-179419648 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
917958621 1:180125346-180125368 GTGGTGGGAGGCAGGTGGCTGGG + Intergenic
918447521 1:184630029-184630051 GTGGTGAGAAGGAGGGAGGGAGG + Intergenic
919411158 1:197245203-197245225 GTGGGGTGAGGGAAGTGGGGAGG - Intergenic
919423722 1:197405059-197405081 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
919756171 1:201067426-201067448 GTGATGGGAAGGAGGTGGAGAGG - Intronic
919928860 1:202208454-202208476 GTGATGTGAGGGAGGTGCCAGGG + Intronic
921004974 1:211084424-211084446 GTGACGAGAGGGAGCTGGCAGGG + Intronic
921142869 1:212322217-212322239 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
921220494 1:212970236-212970258 GAATGGAGAGGGAGGTGGCGAGG - Intronic
921238559 1:213153241-213153263 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
921274469 1:213505261-213505283 GTGGGCAGAGGGAGGTGGGTAGG + Intergenic
921326378 1:213989143-213989165 GAGGAGAGAGGGAGGTGGGGGGG + Intronic
921446585 1:215254361-215254383 GGGGTGAGAGGGAGGTAGGTCGG + Intergenic
921675298 1:217969278-217969300 GTGGTGGCAGGGCGGTGGGGAGG - Intergenic
921902956 1:220467530-220467552 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
922039304 1:221880679-221880701 GTGGTGAGATGGTGATGGTGGGG + Intergenic
922573222 1:226645816-226645838 ATGGTGGGAGGGAGGTGGCCAGG + Intronic
922573687 1:226648124-226648146 GTGTTGGGAGGAAGGTGGCTAGG - Intronic
922632635 1:227132123-227132145 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
923008816 1:230072353-230072375 GTGGTGGGGCGGGGGTGGCGGGG + Intronic
923468415 1:234268454-234268476 GTGGAGAGAGGGAGAGGGAGAGG + Intronic
923793199 1:237128386-237128408 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
924194442 1:241590967-241590989 ATGGTCAGAGGGTGGAGGCGGGG + Intronic
924415183 1:243850332-243850354 GAGGAGAGAGGGCGGCGGCGGGG + Intronic
924765809 1:247031548-247031570 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
924788223 1:247219929-247219951 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
924871616 1:248053100-248053122 GTTGTGGGAGGGCGGTGGAGGGG - Intronic
1063459748 10:6207424-6207446 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1063939000 10:11107998-11108020 GTGGGGAGAGGGAGGGAGTGGGG - Intronic
1063939017 10:11108056-11108078 GTGGGGAGAGGGAGGGAGTGGGG - Intronic
1063939030 10:11108090-11108112 GTGGGGAGAGGGAGGGAGTGGGG - Intronic
1064108835 10:12520929-12520951 GTGGGGAGAGGGAGAGGGAGGGG + Intronic
1064109272 10:12523757-12523779 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1064468878 10:15614932-15614954 GTGGGGAGATGGAGGGGGCTGGG + Intronic
1064566430 10:16644090-16644112 GTGGGCAGAGGGTGGTGGGGGGG + Intronic
1065310222 10:24408565-24408587 GAGGTGAGAGGAGGGTGGCAGGG - Intronic
1065594583 10:27297489-27297511 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1066952747 10:42137551-42137573 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1067258575 10:44666552-44666574 ATGGTGAGTGGGGGGTGGGGAGG + Intergenic
1067332015 10:45330921-45330943 GTGGGGAGAGGGAGACGGAGAGG + Intergenic
1067339597 10:45391053-45391075 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1067354290 10:45511384-45511406 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1068678466 10:59793043-59793065 GTTGGGAGATGGAGGCGGCGTGG + Exonic
1068734660 10:60399377-60399399 GTGGTGGGAGGGAGGAGGATGGG - Intronic
1069889571 10:71644609-71644631 CTGGTGAGAGGGTGGCTGCGAGG - Intronic
1069930222 10:71876708-71876730 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1070111414 10:73490729-73490751 GGGGTGAGAGGGAGAGGGAGAGG - Intronic
1070367623 10:75751352-75751374 CTGGGGAGAGGGAGGGGGAGTGG + Intronic
1070507456 10:77126718-77126740 GTGGTGGGGGGGGGGTGGGGGGG - Intronic
1070644121 10:78189598-78189620 ATGGAGAGAGGGAGTTGGGGAGG + Intergenic
1070655122 10:78266231-78266253 GTGATGTGAGGGAGGTGGGAAGG + Intergenic
1070684326 10:78469696-78469718 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1070814119 10:79312532-79312554 GTCCTGAGAGGCAGGTGGAGGGG + Intronic
1070966293 10:80533372-80533394 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1071320607 10:84452823-84452845 GTGGGGGGAGGGGGGCGGCGGGG - Intronic
1071616290 10:87079929-87079951 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1071710083 10:88041472-88041494 GTGGTGAGAGGGAGGAGGGGTGG + Intergenic
1072191049 10:93076291-93076313 GTGGTGAGTGTGGGGTGGGGGGG + Intronic
1072195635 10:93115470-93115492 GCTGTGAGAGGGTGGTGGCCAGG + Intergenic
1072291538 10:93970023-93970045 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1072956301 10:99891173-99891195 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1073539227 10:104304842-104304864 GGGGTGAGAGGGAGGAGGACGGG - Intronic
1073843811 10:107528975-107528997 GTGGGGAGGGGGAGGGGGGGAGG + Intergenic
1073943912 10:108729768-108729790 GTGGAGGGAGTGAGGTGGAGGGG + Intergenic
1074117292 10:110465973-110465995 GTGGTGAGAGGTTGGTGATGGGG + Intergenic
1074154068 10:110783050-110783072 GAGGTGGGAGGTAGGTGGTGGGG + Intronic
1075128636 10:119721366-119721388 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1075137377 10:119796065-119796087 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075206398 10:120453156-120453178 GTGGCGGGTGGCAGGTGGCGGGG + Intergenic
1075407468 10:122204170-122204192 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075741488 10:124698942-124698964 GTGGTGTGAGTGAGGAGGGGAGG - Intronic
1075835763 10:125451451-125451473 GAGGTGAGAGGAGGCTGGCGAGG - Intergenic
1075842615 10:125517752-125517774 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1076888252 10:133272314-133272336 GGGGTGGGAGGGAAGTGGGGAGG - Intronic
1076895681 10:133310129-133310151 GGGGTCAGAGGGAGGTGACACGG + Intronic
1077052952 11:575959-575981 GGGCTGCGAGGGAGGGGGCGGGG + Intergenic
1077159939 11:1108058-1108080 TGGGTGAGAGGGAGGAGGGGAGG + Intergenic
1077281815 11:1749377-1749399 CCGGGGAGATGGAGGTGGCGCGG - Intronic
1077352793 11:2100633-2100655 GTGCAGAGAGGGAGGTGCCCAGG + Intergenic
1077483833 11:2829934-2829956 GTGGGGAGGGGGAGGGGGAGGGG + Intronic
1077836903 11:5934000-5934022 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1078591015 11:12640970-12640992 GTGGTGGGGGGGATGTGGTGGGG - Intergenic
1078591022 11:12640984-12641006 GTGGTGGGGGGGATGTGGTGGGG - Intergenic
1078591029 11:12640998-12641020 GTGGTGGGGGGGATGTGGTGGGG - Intergenic
1078750721 11:14159895-14159917 GTGGGGGGTGGGAGGTGGGGGGG + Intronic
1078786646 11:14500590-14500612 GTGGGCAGAGGGAGGTGTAGGGG - Intergenic
1079018141 11:16887308-16887330 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1079035197 11:17014426-17014448 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1080097762 11:28429376-28429398 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1080255576 11:30287260-30287282 CTGGTGAGAGGTAAGTGGTGAGG - Intergenic
1081493510 11:43584032-43584054 GTGGGGAGAGGCAGGTGGCTGGG + Intronic
1081950616 11:47039478-47039500 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1081986210 11:47306185-47306207 GTGGGGAGGGGTAGGTGGAGTGG + Intronic
1082818031 11:57523386-57523408 GTGGTGAGAGGATAGTGGTGAGG - Intergenic
1082848634 11:57745776-57745798 GGGGTGTGAGGGTGGTGGCTGGG + Exonic
1083042100 11:59699030-59699052 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
1083071534 11:59988954-59988976 GTTGAGAGAGGGAGGAGGGGTGG - Intergenic
1083130527 11:60621360-60621382 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1083208438 11:61167267-61167289 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1083234960 11:61345387-61345409 GGGCTGACAGGGAGGTGGCTGGG + Intronic
1083592669 11:63904606-63904628 GTGGTGAGAAGGAAGTCTCGTGG - Intronic
1083593057 11:63906484-63906506 GGGGTGAGAGGGAGTGGGGGTGG - Intronic
1083990744 11:66244373-66244395 TTGGTGAGAGGGAGGTGACAGGG - Exonic
1084048739 11:66586987-66587009 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1084085076 11:66851312-66851334 CTGTTCAGAGGGAGGTGGGGTGG - Intronic
1084459354 11:69287556-69287578 GTCGGGGGAGGGTGGTGGCGTGG - Intergenic
1084661964 11:70551312-70551334 GCGGTGGGAGGGAGGGGGAGGGG - Intronic
1084694836 11:70746942-70746964 GTGGAGGGAGGGGGGTGGAGGGG - Intronic
1084925003 11:72503574-72503596 GTGGGGAGGGGGAGGGGGAGAGG + Intergenic
1084933212 11:72573445-72573467 GGGGTGAGGGGGACGCGGCGGGG - Intergenic
1084956576 11:72694810-72694832 GTGGTGATAGGGTGCTGGCAGGG - Intronic
1085112234 11:73898189-73898211 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1085139862 11:74130085-74130107 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1085479440 11:76809199-76809221 GTGGGGATAGGGAGGAGGCCTGG - Intergenic
1085517594 11:77120634-77120656 GTGGTGAGGGGGAGGCGGGGTGG + Intronic
1085609342 11:77933205-77933227 GTGGGGAGAGGGGGATGGAGAGG - Intronic
1085679639 11:78560977-78560999 GTGGGGAAGGGGAGGTGGAGAGG + Intronic
1085743354 11:79095089-79095111 GTGGGGAGAGGGGGGTGAAGGGG + Intronic
1086122805 11:83317856-83317878 GAGGGGAGAGGGAGGGGGAGAGG + Intergenic
1086161538 11:83727374-83727396 GTGGGGAGTGGAAGGTGGAGAGG - Intronic
1086324347 11:85682859-85682881 GTTGTGGGAGGGAGGAGGAGCGG + Intronic
1086338434 11:85823066-85823088 GTGGCAAGAGGGAGGAGGCTGGG - Intergenic
1086341365 11:85852357-85852379 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1086435005 11:86771492-86771514 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1086479552 11:87219448-87219470 GTGGTCAGGGGGTGGTGGCGGGG + Intronic
1086697077 11:89860006-89860028 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1086709081 11:89984481-89984503 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1087198497 11:95322053-95322075 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1087242641 11:95797153-95797175 GTGTTGGGAGGGGGGTGGGGTGG - Intronic
1088074198 11:105826199-105826221 GTGGGGAGAGAGAGGTTGCAGGG + Intronic
1088256941 11:107911788-107911810 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1089148288 11:116346386-116346408 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1089193401 11:116672701-116672723 GTGGGGTGAGGGAAGTGGGGAGG + Intergenic
1089196014 11:116694494-116694516 GTGGGGGGAGGGAGATGGTGGGG - Intergenic
1089338677 11:117743237-117743259 GTGGTGAGAGAGAGGAGTGGAGG + Intronic
1089421294 11:118332732-118332754 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1089706834 11:120284239-120284261 GGGGTGATAGGCAGGTGGAGAGG - Intronic
1089738184 11:120564145-120564167 GTGGGGAGAGGGAGCTGGCTGGG - Intronic
1090152954 11:124404125-124404147 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1090322729 11:125862227-125862249 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1090756650 11:129797777-129797799 GTGATGAGTGGGAGGTGTTGTGG + Intergenic
1090791348 11:130092698-130092720 GTGGGGGGAGGGAGGGGGAGGGG + Intronic
1091093516 11:132794567-132794589 GGGGTTAGAGGGAGATGGGGAGG - Intronic
1091100615 11:132869329-132869351 TTGGTGGGAAGGAGGAGGCGGGG - Intronic
1091121308 11:133060211-133060233 ATGGGGAGAAGGAGGTGGAGGGG - Intronic
1091406717 12:213902-213924 GAGGTGAGCGGGAAGTGGAGGGG - Intronic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091646719 12:2277756-2277778 ATGGTGGGAGGGAGATGGGGAGG - Intronic
1091652971 12:2323533-2323555 GTGGTGAGGGGTAGGTGTGGTGG - Intronic
1091789094 12:3261031-3261053 GTGGTGACAGAGAGGAGGTGGGG + Intronic
1091793084 12:3282686-3282708 GTGGGGAGTGGGAGGTGGCAGGG - Intronic
1091859431 12:3766642-3766664 GTGGGGAGAGAGAGGTGGGAAGG + Intergenic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1092331672 12:7591212-7591234 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1092813244 12:12290881-12290903 TTGATGAGAGAGAGGTGGAGTGG - Intergenic
1093038345 12:14354056-14354078 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1093125500 12:15322979-15323001 GTCTTGAGAGGTAGGGGGCGGGG + Intronic
1093927667 12:24925573-24925595 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1094682537 12:32679182-32679204 GCGCTGCGAGGGAGGTGGAGAGG - Intronic
1095114067 12:38331289-38331311 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1095440951 12:42238272-42238294 GAGGAGGGAGGGAGGGGGCGGGG + Intronic
1096022899 12:48336995-48337017 GATGCCAGAGGGAGGTGGCGAGG + Intergenic
1096041630 12:48521489-48521511 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1096063786 12:48724026-48724048 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1096167749 12:49437841-49437863 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1096224795 12:49860216-49860238 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1096253749 12:50050790-50050812 GCGGGGAGGGGGAGGGGGCGAGG - Intergenic
1096524362 12:52201718-52201740 GTGGTGTGAGGGAGATGGAAGGG + Intergenic
1096626105 12:52897135-52897157 GGGGTGGGAGGGAGGTGGTCAGG - Intergenic
1096856841 12:54489255-54489277 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1096856851 12:54489284-54489306 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1097028717 12:56076732-56076754 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1097088735 12:56488395-56488417 GTGGAGAGAGGGCGGTGCCTGGG + Exonic
1097108016 12:56636420-56636442 GTGGAGAGAGGGAGGAGGCGAGG + Intronic
1097148934 12:56962830-56962852 GTGGGGAGAGGGAGACGGAGAGG - Intergenic
1098277137 12:68824309-68824331 GTGGTGGGCGGGGGGCGGCGGGG - Intronic
1098371097 12:69760415-69760437 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1099141394 12:78980916-78980938 GGGGGGAGAGGGAGATGGAGGGG + Intronic
1099255714 12:80308979-80309001 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1100581838 12:95946634-95946656 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1100606733 12:96158113-96158135 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
1101661164 12:106766678-106766700 GGGGTGAGAGGGCGGCGGCGGGG - Intronic
1101861146 12:108483413-108483435 CTGGAGAGAGAGAGGTGGGGAGG + Intergenic
1101885014 12:108655369-108655391 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1101886085 12:108663681-108663703 GTGGAGGGAGGCAGGTGGAGGGG + Intronic
1102175177 12:110868708-110868730 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1102236230 12:111296260-111296282 CTGGTGAGAGGGATGTGCAGTGG - Intronic
1102509440 12:113404084-113404106 GTGGAAAGAGGGAGGAGGAGTGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103300064 12:119919712-119919734 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1103591085 12:121992986-121993008 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1103698332 12:122835024-122835046 GTGGGGAGAGGGAATTGGCTGGG + Intronic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1103872834 12:124102980-124103002 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1103937835 12:124485949-124485971 GGAGTGGGAGGGAGGTGGGGTGG - Intronic
1104038345 12:125114035-125114057 GGGGTGAGGGGGATGTGGTGGGG - Intronic
1104351090 12:128044626-128044648 GTGGTGAGAGGTAGGTAACAAGG - Intergenic
1104657196 12:130582111-130582133 GAGGAGGGAGGGAGGTGGAGGGG - Intronic
1104713047 12:130998186-130998208 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1104727859 12:131088658-131088680 GTCGTGAGGGGCAGGAGGCGGGG + Intronic
1105367517 13:19778390-19778412 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1105527260 13:21187415-21187437 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1105729044 13:23193239-23193261 GAGGTGAGATGGAGCTGGAGAGG + Intronic
1105900232 13:24746668-24746690 GTGGGGAGAGCGGGGAGGCGGGG + Intergenic
1105956561 13:25288245-25288267 GTGGTGGGGGGGTGGCGGCGGGG + Intergenic
1105971104 13:25429846-25429868 TTGGTGACAGGGAGGTGGCCTGG + Intronic
1105977000 13:25481168-25481190 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1106063702 13:26322518-26322540 GTGGTGAGTGGGAGGAGACAGGG + Intronic
1106177409 13:27343002-27343024 GAGGAGGGAGGGAGGGGGCGAGG - Intergenic
1106486163 13:30174462-30174484 CCGGTGAGTGGGATGTGGCGGGG + Intergenic
1107165614 13:37279533-37279555 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1107552578 13:41491077-41491099 GTGGAGTGGGGGAGGGGGCGCGG + Intergenic
1107589090 13:41882816-41882838 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1107605145 13:42048997-42049019 GTGGAAAGCGGGAGGTGGAGAGG + Intronic
1108110783 13:47069612-47069634 GTGTTGAAAGGGAGGTGGAAAGG + Intergenic
1108206462 13:48095040-48095062 GTGGTGAGAAGGAGAAGGAGCGG - Exonic
1108370152 13:49761201-49761223 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1108501786 13:51077133-51077155 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1108559297 13:51627277-51627299 GTGGTGAGCGGGAAGGGGCAGGG + Intronic
1111560061 13:89932836-89932858 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1112056361 13:95692117-95692139 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1112431633 13:99355533-99355555 GTGGTGAGAGGGTGGCGTGGGGG - Intronic
1112538800 13:100285956-100285978 GTGGGGAGAGGGAGGGTGAGAGG - Intronic
1112981853 13:105394362-105394384 GTGGTGAGGGGGGGGTTGGGGGG + Intergenic
1113343464 13:109448986-109449008 GTGGAGCGAGGGAGGGGGCCTGG - Intergenic
1113505480 13:110813174-110813196 GTCGTGAGGGGGAGGTCGTGAGG - Intergenic
1113760092 13:112840854-112840876 GTGGTGGGAGGGACATGGGGAGG - Intronic
1113823354 13:113231438-113231460 GTGGGGAGTGGGAGGTGGGGAGG + Intronic
1113836615 13:113332203-113332225 GTGCAGATAGGGAGGTGACGGGG - Intronic
1113924171 13:113930976-113930998 GTGGCGAGAGGGAGCCGGCTGGG + Intergenic
1114164991 14:20212032-20212054 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1114213049 14:20632397-20632419 GTGGTGGGTGGGTGGTGGGGGGG - Intergenic
1114320564 14:21543903-21543925 GTGGTGGCAGGGAGTTGGCGGGG + Intergenic
1115035515 14:28852053-28852075 CTGGTGAGAGGCATGTGGCTGGG + Intergenic
1115284282 14:31700816-31700838 GTGGTGGGGGGGAGGGGGCTGGG - Intronic
1115761548 14:36582185-36582207 GGGGTGGGAGGTAGGAGGCGTGG - Intronic
1115847840 14:37556524-37556546 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1116408956 14:44600799-44600821 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
1116657793 14:47674080-47674102 GTGGAGAGGAGGAGGCGGCGGGG + Intronic
1117276827 14:54202602-54202624 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1118125706 14:62901365-62901387 GGGGAGAGAGGGAGGGGGCAAGG - Intronic
1118209517 14:63752070-63752092 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1118239172 14:64038855-64038877 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1118452867 14:65919676-65919698 GAGGTGGGAGGGAGATGGGGAGG - Intergenic
1118480174 14:66156816-66156838 GGGGTGGGAGGGGGGTGGGGGGG - Intergenic
1118489925 14:66249040-66249062 AGGGTGAGGGGGAGGTGGGGAGG + Intergenic
1118517909 14:66546784-66546806 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1118584532 14:67340682-67340704 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1118890184 14:69902600-69902622 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1119206062 14:72794435-72794457 CTGGTGAGATGGTGGTGGTGGGG - Intronic
1119421683 14:74511140-74511162 GTGGGCAGAGGGAGGTGGCTTGG - Intronic
1119522080 14:75294051-75294073 GTGTAGAGAGGGCGGTGGAGGGG - Intergenic
1119595180 14:75926083-75926105 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1119655175 14:76412438-76412460 GTGGTGAGGGAGAGGTAGAGGGG - Intronic
1119895972 14:78220340-78220362 GTGCAGAGAGGGAGGAGGGGAGG + Intergenic
1120057376 14:79940532-79940554 GTGCTGAGGGGGGGGGGGCGGGG - Intergenic
1120086920 14:80285981-80286003 GTGGGGAGAGGGAGATGGAGAGG - Intronic
1120310047 14:82815299-82815321 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1120835448 14:89035136-89035158 GAGGTCAGAGGAAGGTGGAGGGG - Intergenic
1121143094 14:91558393-91558415 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1121156836 14:91693557-91693579 GTGCTGAGAGGGAGTTGGAACGG - Intronic
1121438139 14:93932335-93932357 GGGGTGAGTGGGAGGTGTAGGGG - Intergenic
1121592372 14:95125699-95125721 GAGGGGAGAGGGAGGAGGAGGGG + Intronic
1121958913 14:98240626-98240648 GGGGTGAGAGGCAGGAGGTGAGG - Intergenic
1122233898 14:100321399-100321421 GTGGAGAGAGAGAGGTGTCCAGG + Intergenic
1122447893 14:101782204-101782226 GAGGAGAGAGGGAGGGGGAGGGG - Intronic
1122448012 14:101782522-101782544 GAGGAGAGAGGGAGGGGGAGGGG - Intronic
1122448231 14:101783151-101783173 GGGGAGAGAGGGAGGGGGAGGGG - Intronic
1122784816 14:104158740-104158762 GTGGGGAGGGGGAGTTGGCATGG + Intronic
1122913556 14:104845394-104845416 ATGGGGAGAGGGTGGTGGGGTGG - Intergenic
1122921210 14:104881028-104881050 GTGGTGAGAGGCAGGTGATGGGG + Intronic
1122957931 14:105080052-105080074 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1123006748 14:105327449-105327471 GTGGTGACAGGGGGCTGGGGTGG + Intronic
1202917431 14_GL000194v1_random:189940-189962 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124055116 15:26235126-26235148 GTGGTGGGAGGGAGGCGGGGTGG - Intergenic
1124335253 15:28850653-28850675 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1124335271 15:28850705-28850727 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1124383721 15:29188991-29189013 GTGGAGAGATGCATGTGGCGAGG - Intronic
1124404744 15:29383048-29383070 TTGGGGAGAGGGAGGAGGCCAGG - Intronic
1124636163 15:31366320-31366342 TTGGTGAGAGGAAGGGGGCTGGG - Intronic
1124707626 15:31978538-31978560 GTGGGGAGAGGGTGGTGGAAGGG - Intergenic
1124900338 15:33816829-33816851 GGGGTGAGAGGGAGGTCAAGAGG - Intronic
1125181082 15:36881238-36881260 GTGCTGATAGGGAGGAGGAGGGG - Intergenic
1125395259 15:39240529-39240551 GGAGTGAGAGGGAGGTGAGGTGG + Intergenic
1125593895 15:40872500-40872522 GAGGAGAGAGGGAAGTGGGGTGG - Exonic
1125677784 15:41511846-41511868 GCGCTGGGCGGGAGGTGGCGGGG - Exonic
1125868316 15:43075970-43075992 GTGGAGAGAGGGAGAGGGAGAGG - Intronic
1126571456 15:50157738-50157760 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1126672201 15:51126587-51126609 GTGGTGGGAGGGAGGGAGTGTGG + Intergenic
1126752104 15:51886710-51886732 GTGGAGAGAGGGAGAGGGAGAGG + Intronic
1126778575 15:52119490-52119512 GAGGAGAGAGGGAGGAGGAGGGG + Exonic
1127390404 15:58500734-58500756 GGGGGGAGAGGGGGGTGGTGGGG - Intronic
1127438260 15:58979700-58979722 GTGGTGAGAGAGAGGTGAAAAGG + Intronic
1127451275 15:59118741-59118763 GAGGTGAGTGGGAGATGGCTGGG + Intronic
1127783153 15:62333322-62333344 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1127836557 15:62795308-62795330 GTGGTGAGAGCCAGGTGAAGCGG + Intronic
1127874134 15:63098258-63098280 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1127993998 15:64141893-64141915 GAGGGGAGAGGGAGGTAGCTAGG + Intronic
1128105759 15:65043556-65043578 GTGATGAGGGGGAAGTGGCATGG - Intergenic
1128597651 15:68965528-68965550 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1129028895 15:72604628-72604650 GTTCTGAGAGGGAGGTTGTGGGG + Intergenic
1129054325 15:72808081-72808103 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1129450318 15:75647833-75647855 GTGGGGAGAGGGAGGAGGGAGGG - Intronic
1129465376 15:75721737-75721759 GGGGTGGGTGGCAGGTGGCGAGG + Intergenic
1129760051 15:78124073-78124095 GGGATGACAGGGAGGTGGCTGGG + Intronic
1129885030 15:79031657-79031679 GGAGGGAGAGAGAGGTGGCGAGG + Intronic
1130341014 15:82999147-82999169 GTGGGGAGAGGGAGAGGGTGAGG + Intronic
1130428540 15:83823183-83823205 GTGGGGAGAGGGAGAGGGTGAGG + Intronic
1130555929 15:84922530-84922552 CAGGTGAGAGGCAGGTGGCCCGG - Intronic
1131044052 15:89297763-89297785 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1131077251 15:89503147-89503169 GTGGGGAGAGGGAGGTAGCCTGG - Intergenic
1131126994 15:89867031-89867053 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1131393573 15:92069103-92069125 GGGGGGAGTGGGGGGTGGCGGGG - Intronic
1131603199 15:93871177-93871199 GTGGTGAGAGGGATGAAGCAAGG - Intergenic
1132089276 15:98934833-98934855 CTGATGAGTGGGAGGTGGCTCGG + Exonic
1132321088 15:100926253-100926275 GGTGTGAGATCGAGGTGGCGTGG + Intronic
1132478207 16:153067-153089 GTGGGGAGGGGGCGGTGGGGAGG + Intronic
1132989203 16:2784495-2784517 GTGGTGGGTGGGGGGTGGGGTGG + Exonic
1132992425 16:2802858-2802880 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1133020786 16:2966114-2966136 CGGGTGGGAGGGAGGTGGTGGGG - Intronic
1133327296 16:4949481-4949503 TTAGTGGGAGGGAAGTGGCGGGG - Intronic
1133392818 16:5422980-5423002 GTGGGGAGAGGGAGGAGGGGAGG + Intergenic
1133392839 16:5423040-5423062 GTGGGGAGAGGGAAGAGGGGAGG + Intergenic
1133558914 16:6931898-6931920 CATGTGAGAGGGAGGAGGCGAGG + Intronic
1133584957 16:7184195-7184217 GTGGAGAGAAGGAAGTGGAGAGG + Intronic
1133680241 16:8114397-8114419 GTGGGGAGAGGGAGTGGGAGAGG - Intergenic
1133922176 16:10163172-10163194 GTGGGGAGTGGGCGGTGGCATGG + Intronic
1134449496 16:14354442-14354464 GAGGGGAGAGGGAGGAGGAGGGG + Intergenic
1134449506 16:14354464-14354486 GCGGGGAGAGGGAGGAGGAGGGG + Intergenic
1134449516 16:14354486-14354508 GAGGGGAGAGGGAGGAGGAGGGG + Intergenic
1134449531 16:14354525-14354547 GAGGAGAGAGGGAGGAGGAGGGG + Intergenic
1134449541 16:14354547-14354569 GAGGGGAGAGGGAGGAGGAGGGG + Intergenic
1134686047 16:16159459-16159481 GTGATGGGCGGGAGGTGGGGAGG - Intronic
1134821660 16:17251926-17251948 GTGGGGACAGGGAGGGGGCTGGG + Intronic
1135390942 16:22092683-22092705 GTGGTGAGAGGGTGTCGGGGAGG + Intronic
1135639875 16:24110108-24110130 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1135901633 16:26465156-26465178 GGGGTGTGGGGGAGGTGGGGGGG - Intergenic
1136091704 16:27925386-27925408 GTGGTGGGAGGGAGGAGGGGTGG + Intronic
1136385970 16:29926181-29926203 GTGGTGCGAGCGAGATGGGGCGG - Exonic
1136403638 16:30031148-30031170 GTGGGGAGGGGGAGGGGGAGGGG + Exonic
1136913087 16:34159897-34159919 GCGGTGGGAGGGGGGTGGTGGGG - Intergenic
1137240968 16:46654136-46654158 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1137568229 16:49547597-49547619 GTGGTGAGTGGGCCCTGGCGGGG + Intronic
1137714928 16:50592767-50592789 GTGGTGATGGGGAGGGGGAGGGG + Intronic
1137788027 16:51152719-51152741 GTGGGGGGAGGGCGGTGGGGAGG + Intergenic
1138043205 16:53697322-53697344 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1138142428 16:54580436-54580458 GTGGGGAGAGTGGGGTGGGGTGG - Intergenic
1138144243 16:54594938-54594960 GGGGAGGGGGGGAGGTGGCGGGG - Intergenic
1138400747 16:56741002-56741024 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1138445441 16:57060345-57060367 GTGGTGTGGGGGAGGTGGGAAGG - Intronic
1138488915 16:57364772-57364794 GTGGGGAGAGGGAAGAGGCCAGG - Exonic
1138606937 16:58095572-58095594 TAGGTGAGAAGGAGGTGGGGTGG - Intergenic
1139006239 16:62574839-62574861 GGTGTGAGAGGGAGGAGGTGTGG - Intergenic
1139394585 16:66630322-66630344 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1139513974 16:67442676-67442698 GTGGGGGGAGGGATCTGGCGAGG - Intronic
1139623394 16:68164403-68164425 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1139864014 16:70050322-70050344 GTGGAGAGAGGGAGGGGGAGGGG - Intergenic
1139946440 16:70645434-70645456 GGGGAGACAGGGAGGAGGCGAGG + Intronic
1140205277 16:72928119-72928141 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205286 16:72928138-72928160 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205295 16:72928157-72928179 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205304 16:72928176-72928198 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140409557 16:74733828-74733850 GTGGTGAGCGGGGGCAGGCGGGG - Intronic
1140442543 16:74998975-74998997 GGGGGGAGGGGGAGGGGGCGCGG + Intronic
1140993916 16:80242561-80242583 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1141054446 16:80803527-80803549 GGGGGGTGAGGGAGGTGGCCCGG + Intronic
1141181261 16:81754436-81754458 GTGGTGGGGAGGAGGTGGGGAGG - Intronic
1141431028 16:83970194-83970216 GTGATGAGCGGGGGGTGGGGCGG + Intronic
1141490677 16:84370489-84370511 GAGGAGGGAGGGAGGTGGGGAGG + Intronic
1141520726 16:84577125-84577147 GTTGTGGGAGGGAGGTGTAGGGG - Intronic
1141682836 16:85554300-85554322 GGTGTGAAAGGGAGGCGGCGTGG + Intergenic
1141694640 16:85613708-85613730 GTGGGGGGATGGGGGTGGCGGGG + Intronic
1141719169 16:85745961-85745983 GTGGTCAGAGAGAGATGGCCAGG + Intronic
1141759451 16:86018222-86018244 GAGGAGAGGGAGAGGTGGCGGGG + Intergenic
1141840176 16:86568783-86568805 GTGGCGATAGAGAGGCGGCGTGG - Exonic
1142065637 16:88060859-88060881 ATGGTGAGAGGGAGGGTGGGCGG - Intronic
1142134276 16:88444485-88444507 GTGGGGAGAGGGGGATGGAGAGG + Intergenic
1142533433 17:597955-597977 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1142560012 17:804232-804254 GTGGTGAGCGGGAGGGGGTGAGG + Intronic
1142613748 17:1123579-1123601 GAGCAAAGAGGGAGGTGGCGCGG + Intronic
1142657574 17:1404032-1404054 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1142705439 17:1690646-1690668 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1142810821 17:2394855-2394877 GGGGTGAGTGGGGTGTGGCGGGG - Exonic
1142825153 17:2506257-2506279 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1142861315 17:2763758-2763780 GTGGAGAGCGGGAGGAGGGGAGG + Intergenic
1142949034 17:3463964-3463986 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1143008648 17:3853600-3853622 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1143031887 17:3972564-3972586 GTGGTGAAGGGGAAGTGGCGGGG + Intergenic
1143125444 17:4638809-4638831 TGGGTGAGAGGGAGGTGTCCTGG - Intronic
1143125912 17:4640819-4640841 GTGAAGAGAGGAAGGAGGCGCGG + Intronic
1143125967 17:4641098-4641120 GTGGTGAGAGGGAAGGGATGGGG - Intronic
1143402515 17:6655725-6655747 GTGGTGAGAGGGAAGGGATGGGG + Intergenic
1143402568 17:6656003-6656025 GTGAAGAGAGGAAGGAGGCGCGG - Intergenic
1143403024 17:6658003-6658025 TGGGTGAGAGGGAGGTGTCCTGG + Intergenic
1143461642 17:7108157-7108179 GTGGCCAGAGAGAGGTGGGGAGG - Intronic
1143502539 17:7347602-7347624 GTGGTGGAAGGGAGGTGACATGG + Intronic
1143704613 17:8687727-8687749 GTGGGGAGGGGGAGGGGGAGAGG - Intergenic
1143783184 17:9240075-9240097 GTGGGGGGAGGGAGGGGGCGGGG + Exonic
1143858336 17:9869468-9869490 GTGGTGAAAAGCAGGTGGCTGGG - Intronic
1144161689 17:12566447-12566469 GTAGTGAGAGGGAGGGAGCAAGG - Intergenic
1144305682 17:13967354-13967376 GTGGAAAGAGAGAGGTGGCAGGG + Intergenic
1144407618 17:14967343-14967365 GGGGAAAGAGGGAGGGGGCGAGG - Intergenic
1144736990 17:17560828-17560850 GGGGTGAGGTGGAGGTGGGGAGG - Intronic
1144866204 17:18337559-18337581 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
1145026904 17:19475324-19475346 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
1145047463 17:19628870-19628892 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1145895970 17:28458191-28458213 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1145911339 17:28545038-28545060 TTGGAGAGAGGGAGGAGGTGAGG - Intronic
1145936591 17:28717945-28717967 GTGGAGAGGAGGGGGTGGCGAGG - Intronic
1145985893 17:29045972-29045994 GAGGTGGGAGGGAGGTGGGATGG - Intronic
1146049045 17:29533828-29533850 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1146155722 17:30522807-30522829 GTGGGGAGAGGGAGAGGGAGAGG - Exonic
1146630151 17:34463808-34463830 GTGCTGTGACGGAGGTGGCGGGG - Intergenic
1146731465 17:35196015-35196037 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1147036424 17:37684959-37684981 GTGGTGGGAGGAAGGTGTGGGGG + Intergenic
1147172434 17:38630214-38630236 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
1147278249 17:39336969-39336991 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1147417973 17:40307384-40307406 GGGGTGAGAGGGTGGAGGTGGGG - Intergenic
1147622156 17:41875404-41875426 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1147623064 17:41880986-41881008 GTGGGGATGGGGAGGTGGGGTGG + Intronic
1148016141 17:44523983-44524005 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1148269762 17:46253750-46253772 GTGGGGAGAGGGAGAGGGAGGGG + Intergenic
1148393425 17:47289971-47289993 GTGGTGGAGGGGAGGTGGTGAGG + Intronic
1148485128 17:47985946-47985968 GTTGTGAGAGGGCGGTGGGGTGG + Intergenic
1148509839 17:48159034-48159056 GAGGTGAGATGGAGGTGGCAGGG - Intronic
1148789641 17:50166134-50166156 GTGGTAAGACGGAGGTGTGGAGG + Intronic
1148857070 17:50584610-50584632 GGGGTGACAGGGGGGCGGCGGGG + Intronic
1149431254 17:56596713-56596735 GAGGTGGCAGGGAGGTGGGGAGG - Intergenic
1149632853 17:58141812-58141834 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1149780817 17:59395076-59395098 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1150213741 17:63455825-63455847 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1150311765 17:64134907-64134929 GTGGTGAGTGATAGGTAGCGGGG - Intergenic
1150477069 17:65483781-65483803 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1150559562 17:66282859-66282881 GGGATGAGAGGGAGGTGGGAAGG - Intergenic
1150567545 17:66355302-66355324 CTGATGAAAGGGAGGTGGTGAGG + Intronic
1150660581 17:67072656-67072678 GGGGTGAGAGTGAGGAGGGGTGG + Exonic
1150894796 17:69197001-69197023 GTGGACAGAGGGAGGGGGAGGGG + Intronic
1150984840 17:70184519-70184541 GAGGGGAGAGGGAGGGGGAGGGG - Intergenic
1150984852 17:70184541-70184563 GAGGGGAGAGGGAGGGGGAGGGG - Intergenic
1151200875 17:72467331-72467353 GTGATGAGAAGGAGGTGTCTGGG + Intergenic
1151223647 17:72632362-72632384 GTGGTGGGAGGGTGGAGGCAGGG - Intergenic
1151370481 17:73643984-73644006 GTGGGGACAGGGAGGGGGCTGGG - Intronic
1151470224 17:74313449-74313471 GTGGTGAGTGGGAGGAGCCCTGG - Intronic
1151470430 17:74314420-74314442 TTGGAGAGAGGGAAGGGGCGGGG + Intronic
1151491028 17:74432429-74432451 GGGGTGGGAGGGACGCGGCGCGG - Intronic
1151495416 17:74455265-74455287 GTGGTGAGAGGGCTGGGGCAGGG + Intergenic
1151599898 17:75099828-75099850 GTGCCTACAGGGAGGTGGCGAGG + Intronic
1151820361 17:76493667-76493689 GTGCTGAGAGGGAGGGAGAGTGG - Intronic
1152077682 17:78169099-78169121 GTGGGGTAAGGGAGGGGGCGGGG + Intronic
1152117455 17:78397373-78397395 GTGTGGAGAGGGAGGTGCAGTGG + Intronic
1152274663 17:79349286-79349308 GTGGTGAGAGGTGGGAGGAGAGG - Intronic
1152336947 17:79703959-79703981 GTGGGGGGTAGGAGGTGGCGTGG + Intergenic
1152479088 17:80538041-80538063 GTGGGGAGAGGGAGCGGGAGCGG + Intergenic
1152518663 17:80841998-80842020 GTGGTGAGAGTGAGCTGCGGTGG - Intronic
1152640043 17:81445521-81445543 GTGGGGTGGGGGAGCTGGCGGGG - Exonic
1153553594 18:6286760-6286782 GTGGGGAGAGAGAGGTGACCTGG - Intronic
1153690771 18:7591374-7591396 GTGGTCAGAGGGAGGGAGTGGGG + Intronic
1154097310 18:11430311-11430333 GGGGTGAGGGGGAGGCGGGGAGG + Intergenic
1154098444 18:11444172-11444194 GTGGGGAGAGGGAAGGGGGGAGG - Intergenic
1154282270 18:13015128-13015150 GTCAGGTGAGGGAGGTGGCGTGG + Intronic
1154290123 18:13099167-13099189 ATGGGGAGAGGGAGGGGGAGGGG + Intronic
1155486787 18:26352755-26352777 TTGGAGAGAGGGGTGTGGCGGGG - Intronic
1156014996 18:32537537-32537559 GTGCTGAGAGGGAGATGCAGTGG + Intergenic
1156289089 18:35729738-35729760 GAGGTGAGAGGGAGGGAGGGAGG + Intergenic
1156326528 18:36078686-36078708 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1156360349 18:36379187-36379209 CTTGTGAGAGAGAGGTAGCGTGG + Intronic
1157186079 18:45540963-45540985 GTGATGAGAGGGAAGGGGTGAGG + Intronic
1157334967 18:46731472-46731494 GGGGCGAGAGGGAGGTGAAGGGG - Intronic
1157677618 18:49578999-49579021 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1157794085 18:50559591-50559613 GTGGGGAGAAGGAGCCGGCGGGG - Intergenic
1158462258 18:57656729-57656751 GTGGGGAGAGAGGGGTGGGGAGG + Intronic
1158551701 18:58441551-58441573 GTGGAGAGAGGGAGGCGAGGTGG + Intergenic
1158851078 18:61496163-61496185 GGGGGGAGAGGGAGGGGGAGAGG - Intronic
1159040502 18:63319768-63319790 GTGGGGAGAAGGAGGTGGTGGGG + Exonic
1159783309 18:72684457-72684479 GTGGGGAGAGAGAGGCGGGGAGG + Intergenic
1160161279 18:76472959-76472981 GTGGGGAGAGGGAGGAGATGGGG + Intronic
1160220448 18:76973667-76973689 ATGCTGCGAGGGAGGTGGCGTGG + Intergenic
1160228577 18:77029423-77029445 GTGGGGAGAGGGAGAGGGAGGGG + Intronic
1160375774 18:78410468-78410490 GTGGTGTGAGGTGGGTGGAGAGG - Intergenic
1160412971 18:78687600-78687622 GTGGGGAGGGACAGGTGGCGGGG - Intergenic
1160507854 18:79437231-79437253 GTGGAGAGAGGGGTCTGGCGTGG + Intronic
1160710451 19:548862-548884 GGGGTGAGAGTGCGGGGGCGGGG - Intronic
1160930937 19:1569042-1569064 GTGGGGCGGAGGAGGTGGCGTGG - Intergenic
1161262338 19:3344968-3344990 AGGGAGAGAGGGAGGAGGCGAGG + Intergenic
1161267203 19:3369835-3369857 GTGGCGGGATGGAGGTGGCTCGG - Intronic
1161277470 19:3426680-3426702 GGGGAGAGAGGGAGGAGGGGAGG - Intronic
1161317514 19:3624620-3624642 TGGGGGAGAGGGAGGAGGCGCGG + Intronic
1161393091 19:4031496-4031518 GAGGGAAGAGGGAGGTGGGGCGG - Intronic
1161490386 19:4557953-4557975 GGGGAGAGAGAGAGGAGGCGAGG - Intronic
1161499143 19:4603688-4603710 GGGGTGAGAGGGTGGTGGGTGGG + Intergenic
1161505780 19:4642731-4642753 GAGGAGAGAGGGAGGAGGGGAGG + Intronic
1161846931 19:6717068-6717090 GGGGAGAGAGGGAGGAGGGGAGG + Intronic
1161994081 19:7701863-7701885 GTGGTGAGGGGGCGGGGGTGGGG - Intronic
1162085612 19:8247250-8247272 GGGGAGAGAGGGAGGAGGGGAGG - Intronic
1162156390 19:8680945-8680967 GGGGAGAGAGGGAGGAGGCGAGG + Intergenic
1162254940 19:9482646-9482668 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
1162278798 19:9679324-9679346 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1162392841 19:10399967-10399989 GTGGAGAAAGGGAGTTGGAGAGG - Intronic
1162538361 19:11277506-11277528 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1162723614 19:12676651-12676673 CTGGTGAGGGGAAGGTGGAGTGG - Intronic
1162792878 19:13072130-13072152 CTGGCGAGAGGGTGGTGGAGGGG - Intronic
1163001439 19:14370303-14370325 GTAGGGAGAGGGAGGTGCCCAGG + Intergenic
1163110778 19:15160007-15160029 GTGAAGTGAGGGAGGTGGGGTGG + Exonic
1163142874 19:15362366-15362388 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1163462573 19:17448018-17448040 GTGGGGAGAGGGAAGTGGGGAGG + Intronic
1163663867 19:18594195-18594217 GTGGGGACAGGGAGCTGGGGGGG - Intronic
1163834503 19:19564942-19564964 GTGTTGACAGGCAGCTGGCGTGG + Exonic
1163986268 19:20953438-20953460 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1164106282 19:22108696-22108718 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1164263760 19:23594142-23594164 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1164462888 19:28463891-28463913 GAGATGAGAGGAAGTTGGCGAGG - Intergenic
1164998722 19:32743363-32743385 GTGGGGAGAGGGAGTGGGGGAGG - Intronic
1165489429 19:36114716-36114738 GTGGGGAGGGGGAGGTGCCAGGG + Intronic
1165727892 19:38125014-38125036 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1165749411 19:38251160-38251182 GAGGAGAGAGGGAGGTTGTGGGG + Intronic
1166640004 19:44488067-44488089 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1166995794 19:46719190-46719212 GATGTGTGAGGGTGGTGGCGAGG - Intergenic
1167348376 19:48960939-48960961 GTGGTGAGGGCGCGGTGGTGGGG - Exonic
1167506304 19:49872897-49872919 GAGGTGAGAGGGTGGGGGCAGGG - Exonic
1167521377 19:49958187-49958209 GTGGGGAGAGGGTGTGGGCGTGG - Intronic
1167635033 19:50649361-50649383 GTGGGGAGAAGGAGCTGGGGTGG + Intronic
1167980804 19:53273206-53273228 GTGGTGAGAGGGAGGCCACAGGG + Intergenic
1168099537 19:54133917-54133939 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099605 19:54134102-54134124 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099620 19:54134141-54134163 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1168099656 19:54134243-54134265 GTGGAGAGAGGGAGGGAGAGGGG - Intergenic
1168099669 19:54134278-54134300 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1168099679 19:54134305-54134327 GTGGAGAGAGGGAGGGAGAGAGG - Intergenic
1168174027 19:54609693-54609715 GTGGTGTTAGCAAGGTGGCGGGG - Intronic
1168306165 19:55437558-55437580 GCGGTGAAGGGGAGGGGGCGGGG - Intronic
1168658120 19:58146534-58146556 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
925084557 2:1097845-1097867 GTGGTGAAAGGGAAGTGGGGCGG - Intronic
925318350 2:2941809-2941831 TACGTGAGAGGGAGGTGGCTGGG - Intergenic
925400668 2:3570005-3570027 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
925904177 2:8529494-8529516 AGGGTGAGGGGGAGGTGGCATGG - Intergenic
926010072 2:9400369-9400391 GTGGAGGAAGGCAGGTGGCGGGG - Intronic
926215719 2:10903869-10903891 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
926409711 2:12590277-12590299 CTGAGGAGAGGGAGGTGGAGAGG + Intergenic
926512513 2:13800062-13800084 GTTGGGAGAGGGAAGTGGGGTGG + Intergenic
926675234 2:15613019-15613041 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
926872422 2:17437075-17437097 TTGGGGAGTGGGAGGTGGGGTGG + Intergenic
927845901 2:26472845-26472867 CCGGTGGGAGGGAGGTGGCGGGG + Intronic
928602561 2:32916343-32916365 GGGGTGAGAGGGGGGGGGGGGGG + Intergenic
928858480 2:35827980-35828002 GTGGTGGGGGGGTGGTGGGGGGG + Intergenic
928888642 2:36179306-36179328 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
929445046 2:41994997-41995019 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
929520656 2:42647520-42647542 GGGGTGGGAGGCAGGTGGGGTGG - Intronic
929556972 2:42931688-42931710 GAGGTGGGAGAGAGGTGGCATGG + Intergenic
929561915 2:42961446-42961468 GGGGAGAGAGGGAGGGGACGGGG - Intergenic
929578851 2:43069256-43069278 CTGGTGAGAGCTGGGTGGCGGGG - Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
929690480 2:44068346-44068368 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
929773899 2:44915817-44915839 GTGGGGAGAGGGAGGGAGAGAGG + Intergenic
930056039 2:47252744-47252766 GTGGTGTTAGGGTGGTGGTGGGG + Intergenic
930189186 2:48440764-48440786 GGGGTGGGAGGAAGGTGGAGTGG - Intronic
930396563 2:50829258-50829280 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
930665759 2:54096845-54096867 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
930834134 2:55774737-55774759 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
931479735 2:62629587-62629609 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
931576226 2:63721723-63721745 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
931656485 2:64513196-64513218 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
931783890 2:65601829-65601851 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
931891628 2:66679463-66679485 GTGGTGAGGAGGAGGTGGTCAGG + Intergenic
932070126 2:68611775-68611797 GTGGTGAGAGAGAGGGGGGCGGG + Intronic
932410441 2:71543874-71543896 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
932430985 2:71673377-71673399 CTGGTCTGAGGGAGGTGGGGTGG + Intronic
932431370 2:71675735-71675757 GTGGTGAGATTAAGGTGGGGAGG - Intronic
932448643 2:71795780-71795802 GGGGTGAGAAGCAGGTGGCAAGG + Intergenic
932490213 2:72115501-72115523 GTTGTGACAGGGAGGGGCCGAGG + Intergenic
932573331 2:72949816-72949838 GGGGTGAGAGGGAGGTGTTGAGG + Intronic
932903307 2:75724577-75724599 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
933658438 2:84907304-84907326 GTGGTGGGAGGGAGGAAGGGTGG + Intergenic
933734786 2:85487030-85487052 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
934042037 2:88135475-88135497 CTAGTGAGAGGGAGGTGGACTGG + Intergenic
934548903 2:95242816-95242838 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
934712422 2:96524833-96524855 GTCAGGAGAGGGAGGTGGCCGGG - Intergenic
934793461 2:97082142-97082164 GAGGTGGTAGGGAGGTGGTGGGG + Intergenic
935310819 2:101781533-101781555 ATGGTGAGAGGGAGGGGGAAGGG + Intronic
935636032 2:105250620-105250642 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
935713178 2:105917286-105917308 GCAGTGAGAGGGAGGTGGGGAGG - Intergenic
935926782 2:108078205-108078227 GGGATGAGAGGGAGGGGGAGGGG + Intergenic
936247955 2:110844879-110844901 GAGGGGAGAGGTAGGTGGCCAGG - Intronic
936528335 2:113257568-113257590 ATAGTGAGAGGGAGCTGGGGAGG + Intronic
937168934 2:119845229-119845251 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
937296981 2:120815454-120815476 GTGGAGGGAGGGGGCTGGCGGGG - Intronic
937437421 2:121892066-121892088 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
937475828 2:122214369-122214391 GTTGTGGGAGGGAGCTGGTGGGG + Intergenic
937978649 2:127597421-127597443 CAGGTGTGAGGGAGGGGGCGTGG - Intronic
938093207 2:128446659-128446681 GAGGAGAGAGGGTGGTGGCAGGG + Intergenic
938097069 2:128471104-128471126 GTGGTGGGCGGGAGGAGGCTGGG + Intergenic
938097134 2:128471360-128471382 GTGGTGTGTGGGAGGAGGCTGGG + Intergenic
938097141 2:128471394-128471416 GTGGTGTGTGGGAGGAGGCTGGG + Intergenic
938097219 2:128471688-128471710 GTGGTGTGTGGGAGGAGGCTGGG + Intergenic
938097284 2:128471946-128471968 GTGGTGGGCGGGAGGAGGCTGGG + Intergenic
938374896 2:130798701-130798723 TGGGTGGGAGGGTGGTGGCGCGG - Intergenic
938533622 2:132220359-132220381 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
938537101 2:132256306-132256328 GTGGTGGGAGGGGGGTGGTGGGG + Intronic
938770483 2:134496963-134496985 GCGATGAGTGGGAGGAGGCGTGG - Intronic
939477111 2:142701901-142701923 GTGGGGAGAGGGAGGGGGAGAGG - Intergenic
940298967 2:152159712-152159734 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
940558565 2:155264180-155264202 TTGGTAGGAGGAAGGTGGCGAGG + Intergenic
940719058 2:157261511-157261533 GTGATAAGAGGGAGGAGGCCTGG - Intronic
941197410 2:162469690-162469712 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
941508411 2:166376061-166376083 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
941793511 2:169576154-169576176 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
941814989 2:169787348-169787370 GTGGGGAGAGGGAGAGGGAGGGG + Intergenic
942021198 2:171867634-171867656 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
942116742 2:172735790-172735812 GTGGGGAGAGGGAGGGGACCCGG - Intronic
942355470 2:175107526-175107548 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
942454044 2:176125481-176125503 GCGGTGAAATGGAGGTGGCTGGG - Intergenic
942621211 2:177846032-177846054 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
942712170 2:178848770-178848792 GTGGTGGGGTGGAGGTGGGGAGG + Intronic
942787559 2:179717398-179717420 GTGGAGAGAGGGAGGGAGAGAGG + Intronic
943129400 2:183838130-183838152 GTGGTGAGCGGGATGTGGTGGGG - Intergenic
943173325 2:184433102-184433124 GTGGCGCGGGGGAGGTGGGGAGG - Intergenic
943740195 2:191399266-191399288 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
944223517 2:197325991-197326013 GTGGTGAGGGAGAGATGGTGAGG - Intergenic
944255152 2:197618069-197618091 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
944283733 2:197924134-197924156 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
944680664 2:202073806-202073828 GTGTTGTTAGTGAGGTGGCGGGG + Intronic
944733241 2:202536086-202536108 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
944815759 2:203373482-203373504 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
944914192 2:204341062-204341084 GTGATGACAGAGAGGTGGCAGGG + Intergenic
945538703 2:211055144-211055166 TTGGTGAGAGGGAGGAGGAGGGG + Intergenic
945829186 2:214762877-214762899 GTGGTGGGAGGGGGGTGGGGTGG - Intronic
945988366 2:216372210-216372232 GTGCTGGAAGGGAGGTGGCGGGG + Intergenic
946125719 2:217560893-217560915 GTGGTGAGAGGGTGGGGGGTGGG - Intronic
946157680 2:217817903-217817925 CTGGTGACGGGGAGGTGGCAGGG + Exonic
946159092 2:217825310-217825332 GTGGCTAGAGGGAGGTGGGTAGG - Intronic
946304020 2:218845919-218845941 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
946317961 2:218930782-218930804 GTGGGGAGAGGGAGAAGGAGAGG - Intergenic
946393427 2:219430292-219430314 GTGGTGAGAGGAAGGAGGGAGGG - Intergenic
946650786 2:221891505-221891527 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
947383886 2:229571368-229571390 ATGGTGAGAGGGAGTGGGAGGGG - Intronic
947703725 2:232257491-232257513 AGGGTGGGAGGGAGGTGGAGTGG - Intronic
948178066 2:235959670-235959692 GTGCTGAGAAGGTGATGGCGGGG - Intronic
948695657 2:239732023-239732045 GTGGAGGGTGGGAGGTGGAGGGG - Intergenic
948728342 2:239948030-239948052 GTGGTGAGGTGGAGGAGGTGAGG + Intronic
948738257 2:240025207-240025229 GTGGTGAGCGGGCGGCGGGGTGG - Exonic
949010028 2:241673033-241673055 GTGGTGACGGGGGGGGGGCGGGG + Exonic
1169198200 20:3694505-3694527 GTAGTGAGTGTGACGTGGCGTGG + Exonic
1169404766 20:5314389-5314411 GTGGTGTGAGGGAGGTGCGAGGG + Intergenic
1169496252 20:6118379-6118401 GTGGTGACTGGGAGGGGTCGGGG + Intronic
1169951610 20:11050255-11050277 GTGGTGAAAGGGAATTGGCCTGG - Intergenic
1170028009 20:11912017-11912039 GGGGTGAGCGGGGGGTGGGGAGG - Intronic
1170592040 20:17778560-17778582 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1170732802 20:18988954-18988976 GAGGCGGGAGGGAGGGGGCGAGG + Intergenic
1170753827 20:19178606-19178628 ATGGGGATAGGGAGGTGGCCTGG - Intergenic
1170811823 20:19679585-19679607 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1171289347 20:23972497-23972519 ATGGAGGGAGGGAGGTGGAGAGG + Intergenic
1171317186 20:24205648-24205670 GTGGTGAGAGTGGGGAGGCAGGG + Intergenic
1171366327 20:24627122-24627144 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1171848657 20:30292664-30292686 GTGGGGAGAGGGAGAGGGAGGGG + Intergenic
1171861066 20:30404201-30404223 GTGGCGAGAGGGAGAGGGAGAGG - Intergenic
1171866014 20:30488085-30488107 GTGGTGGGAGGGGGGTGGTGGGG + Intergenic
1172011038 20:31845694-31845716 GTGGGGCGAGGGAGGAGGGGAGG - Intergenic
1172054698 20:32146011-32146033 GTGGTGAGAGGGTGGTAGGCAGG + Intronic
1172058876 20:32175351-32175373 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
1172118149 20:32583797-32583819 GTGGCGTGGGGGAGGGGGCGGGG - Intronic
1172209395 20:33186207-33186229 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1172258285 20:33537506-33537528 GTGGTGAGAGTGAGAGGGAGAGG + Intronic
1172279764 20:33700737-33700759 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1172720797 20:36999475-36999497 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1172722609 20:37011859-37011881 GTGGGGAGAGGGAGTGGGAGAGG - Intronic
1172907047 20:38378112-38378134 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1172907059 20:38378147-38378169 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1172913887 20:38429652-38429674 GTGGTGGGAGGGAGGAGGTGTGG + Intergenic
1172995769 20:39069450-39069472 GTGGTGGGACTGAGGTGGGGGGG + Intergenic
1173006335 20:39142448-39142470 GTGGTGAGGGGGAGGGAGGGGGG + Intergenic
1173255100 20:41388703-41388725 TTGGGGAGAGGGACTTGGCGTGG + Intergenic
1173499244 20:43540343-43540365 ATGGTGAGAGGGAGGAGGAGAGG - Intronic
1173508616 20:43608159-43608181 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1173723354 20:45279287-45279309 GTGATGAGAAGGTGGTGGTGGGG - Intergenic
1173747392 20:45448373-45448395 GTGGGGAGAGGAAGGAGGCAGGG - Intergenic
1173867655 20:46322801-46322823 GCAGTGAGACAGAGGTGGCGGGG + Intergenic
1174063619 20:47849365-47849387 GGGGTGAGGAGGAGGTGGGGAGG + Intergenic
1174280274 20:49434224-49434246 GTGGTTAGTGGGAGGAGGGGTGG - Intronic
1174306577 20:49617756-49617778 GTGTAGAGAGGGTGGTGGTGTGG - Intergenic
1174325531 20:49775622-49775644 CTTGTGAGTGGGAGGTTGCGGGG + Intergenic
1174344683 20:49921433-49921455 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1174835647 20:53853757-53853779 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1175366900 20:58461809-58461831 GAGGTAAGAAGGAGCTGGCGGGG - Intronic
1175416586 20:58805244-58805266 GTGGTGGGAGGAAGCTGGAGAGG - Intergenic
1175524423 20:59623783-59623805 GTGGGGATGGGGAGGTGGCTTGG + Intronic
1175726388 20:61321302-61321324 GAGGGCAGAGGGAGGAGGCGAGG + Intronic
1175762611 20:61571714-61571736 GAGGGGAGAGGGAGGAGGAGAGG - Intronic
1176041383 20:63067718-63067740 GAGGTGGGAGGGAGGAGGGGTGG + Intergenic
1176093043 20:63327408-63327430 GTGGTGGAGGGGAGGTGGTGGGG + Intronic
1176135933 20:63521972-63521994 GTGGGGGGTGGGAGGTGGGGAGG - Exonic
1176151804 20:63595279-63595301 GGGGTGGGAGGGAGGGGGCCGGG + Intronic
1176231643 20:64036068-64036090 GTGGAGAGAGGGAGGGGGCAGGG + Intronic
1176513671 21:7767388-7767410 CAGGGGAGAGGGAGGGGGCGGGG - Intronic
1176513684 21:7767412-7767434 GAGGGGAGAGGGAGGGGGAGGGG - Intronic
1177084406 21:16684591-16684613 TTTGTGATAGGGAGGTGGTGGGG + Intergenic
1177459478 21:21392088-21392110 GTGGAGGGTGGGAGGTGGAGAGG - Intronic
1178295837 21:31409469-31409491 GTGGGGAGCAGGAGGTGGGGTGG - Intronic
1178338471 21:31765196-31765218 GTGGTGGGAGGGACCTGGTGGGG + Intergenic
1178484430 21:33009049-33009071 GTCGGGGGAGGGAGGTGGTGGGG - Intergenic
1178647784 21:34397912-34397934 CAGGGGAGAGGGAGGGGGCGGGG - Intronic
1178647797 21:34397936-34397958 GAGGGGAGAGGGAGGGGGAGGGG - Intronic
1179714342 21:43279980-43280002 GAGGTGAGGTGGAGGTGGAGGGG + Intergenic
1179714681 21:43280755-43280777 GAGGGGAGGTGGAGGTGGCGGGG + Intergenic
1180037368 21:45256741-45256763 GGGGTGCCAGGGAGGTGGAGTGG - Intergenic
1180312723 22:11252959-11252981 GTGGTGGGAGGGGGGTGGTGGGG + Intergenic
1180739453 22:18042395-18042417 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1180825480 22:18858104-18858126 TTGGTGAGATGGAGGCGGAGAGG + Intronic
1180861112 22:19083702-19083724 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1180894735 22:19321953-19321975 ATGGTGAAAGGGAAGTGGTGTGG + Intergenic
1181022356 22:20110100-20110122 GACGTGTGAGGGAGGTGGCACGG + Exonic
1181182513 22:21078013-21078035 GTGGTGGGAGGGGGTGGGCGAGG - Intergenic
1181187252 22:21116443-21116465 TTGGTGAGATGGAGGCGGAGAGG - Intergenic
1181211946 22:21294050-21294072 TTGGTGAGATGGAGGCGGAGAGG + Intergenic
1181272914 22:21670857-21670879 GGTGAGAGAGGGAGGTGGCCAGG + Intronic
1181487214 22:23238872-23238894 GGGGTGGGGGGCAGGTGGCGGGG + Intronic
1181651855 22:24263222-24263244 TTGGTGAGATGGAGGCGGAGAGG + Intergenic
1181728411 22:24827383-24827405 GTGGGGAGAGGGAGGGAGGGCGG + Intronic
1181792491 22:25278634-25278656 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1181792507 22:25278662-25278684 GGGGTGAGGGGGAGGGGGAGAGG + Intergenic
1181950557 22:26550725-26550747 GTGGTGGGTGGGAGTTGGTGTGG - Intronic
1182050982 22:27312334-27312356 GTGGAGAGAGGGAGATTGAGAGG + Intergenic
1182484723 22:30632503-30632525 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1182941586 22:34282233-34282255 GTGGGGAGAGCGGGGGGGCGGGG - Intergenic
1183261293 22:36797534-36797556 GAGGGGAGAGGGAGGGGGAGAGG + Intergenic
1183349096 22:37324836-37324858 GCGGTGCGGGGGAGGGGGCGTGG - Intergenic
1183489379 22:38108522-38108544 CTGGGGGCAGGGAGGTGGCGTGG + Intronic
1183590387 22:38776328-38776350 GGGGTGAGATGGGGGTGGGGAGG - Intronic
1183595040 22:38806314-38806336 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
1183668020 22:39256320-39256342 GTGGGGAGAGGGCTGTGGCTGGG - Intergenic
1183706978 22:39480272-39480294 GTGGTGGGAAGGAGCTGGAGAGG + Intronic
1184072623 22:42155268-42155290 GTGGTGGGCGAGAGGTGGCCTGG + Intergenic
1184230631 22:43156535-43156557 GGGGTGGGAGGGAGGGGGAGGGG + Intronic
1184555067 22:45228729-45228751 GTGGTGGTAGGGGGGTGGAGAGG - Intronic
1184561876 22:45268459-45268481 GGGGTGAGCGGGTGGAGGCGGGG - Intergenic
1184580316 22:45412898-45412920 GAAGTGAGAGGGAGCTGTCGAGG - Intronic
1184614596 22:45629629-45629651 GAGGTGGCAGGGAGGGGGCGGGG - Intergenic
1184629285 22:45763236-45763258 CTGGAGAGAGTGAGGTGGTGAGG + Intronic
1184679619 22:46063277-46063299 CTGCTGAGAGAGGGGTGGCGGGG - Intronic
1184772775 22:46607639-46607661 GAGGAGAGAGGGCGGTGGCTGGG - Intronic
1185411194 22:50683837-50683859 GTGGAGAGGGGGTGGTGGAGAGG + Intergenic
1185416116 22:50711518-50711540 GTGGTGAGAGGGATGGGGTGGGG + Intergenic
1203215008 22_KI270731v1_random:1382-1404 TTGGTGAGATGGAGGCGGAGAGG - Intergenic
1203275628 22_KI270734v1_random:84007-84029 TTGGTGAGATGGAGGCGGAGAGG + Intergenic
949090894 3:27798-27820 GGGGTGGGAGGGTGGTGGTGAGG - Intergenic
949570165 3:5284736-5284758 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
949853154 3:8439035-8439057 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
949854976 3:8452980-8453002 GTGGTCAACGGGAGGTGGCTTGG + Intergenic
950242327 3:11382485-11382507 GTGGGGAGAGGTGGGTGGTGAGG + Intronic
950412893 3:12850534-12850556 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
950417397 3:12876278-12876300 GTGGTGAGCGGCGGGGGGCGGGG - Intergenic
950475973 3:13215047-13215069 GAGGCGAGAGGCAGGTGGTGGGG + Intergenic
950729812 3:14947719-14947741 GAGGTGGGAGCGGGGTGGCGGGG - Intronic
950742222 3:15061201-15061223 GTGGGGAGAGGGAGACGGAGAGG - Intronic
950896442 3:16455952-16455974 GCGGTGGGAGGGAGGTGTCGGGG - Intronic
951911350 3:27753759-27753781 GTGGTGAGTGGGGGGTGGGGTGG + Intergenic
952021536 3:29027485-29027507 GTGGCTAGAGAGGGGTGGCGTGG + Intergenic
953003686 3:38957992-38958014 GAGGAGGGAGGGAGGTGGCCTGG + Intergenic
953257401 3:41305191-41305213 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
953899641 3:46832820-46832842 CTGGTGAGTGGCAGGTGGTGAGG - Intronic
953922150 3:46959699-46959721 GGGGGGACAGGGAGGTGGCAAGG + Intronic
953959341 3:47255726-47255748 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
953966358 3:47309977-47309999 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
954162561 3:48733490-48733512 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
954256788 3:49412676-49412698 GTCGGGAGAGGGTGGGGGCGGGG - Intronic
954296454 3:49677022-49677044 CTGGTGAGCTGGAGGTGGCAGGG + Exonic
954329330 3:49881136-49881158 GGGGTGGGAGGGAGGTGGCAAGG + Intergenic
954356441 3:50085860-50085882 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
954481522 3:50804751-50804773 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
954529951 3:51309596-51309618 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
954924596 3:54221263-54221285 GTGGTGAGAGGGTGGGATCGTGG + Intronic
955060187 3:55486984-55487006 ATGGCGAGGGGGAGGGGGCGCGG + Exonic
955363280 3:58291390-58291412 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
955435110 3:58891420-58891442 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
955699478 3:61669825-61669847 GTGGTGACAGGGAGGAGGGAAGG + Intronic
955699981 3:61672731-61672753 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
956064184 3:65379508-65379530 GTGATGAGAGGAGGCTGGCGAGG + Exonic
956321946 3:68007597-68007619 GGGGAGGGAGGGAGGTGGGGTGG - Intronic
956803685 3:72787712-72787734 GAGGGGAGAGGGAGGGGGAGGGG - Intronic
957316969 3:78584296-78584318 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
957997215 3:87705868-87705890 GGAGTGAGAGTGAGGTGGGGAGG - Intergenic
958916359 3:100054798-100054820 ATGGTGAGAGAGAGGGGGCAAGG - Intronic
959586204 3:108026897-108026919 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
960419530 3:117426715-117426737 GTGGTGAGCCAGAGATGGCGTGG + Intergenic
960590899 3:119364227-119364249 GTGGGGGGATGGAGGTGGGGGGG + Intronic
960861837 3:122163711-122163733 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
960866260 3:122202478-122202500 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
961120941 3:124369056-124369078 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
961216627 3:125165111-125165133 ATGGTGGGAGGGAGGTGGGCTGG - Intronic
961462736 3:127062984-127063006 GTGGTGTGGGGGTGGTGGTGGGG + Intergenic
961625940 3:128263885-128263907 GTGGGGAGAGGGAGGAGGAAAGG - Intronic
961696625 3:128709687-128709709 GTAGCCAGAGGGAGGTGGGGGGG - Intergenic
961729031 3:128953624-128953646 GTGGGGAGAGGGAGACGGAGAGG - Intronic
961789295 3:129364351-129364373 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
961972543 3:130985635-130985657 GTGGGGCGGGGGAGGTGGGGTGG - Intronic
962197689 3:133378193-133378215 GTGGGGAGTGGGAGGCTGCGGGG - Intronic
962421232 3:135230710-135230732 GAGGTGAGAGGGAGGGAGGGAGG - Intronic
962571979 3:136722633-136722655 GAGGGGAGAGGGAGGGGGAGAGG - Intronic
962964001 3:140336921-140336943 GTGGTGTGGGGAAGGTGGGGCGG - Intronic
963058186 3:141204558-141204580 GCGGTGAGAGGGAAGTGCCCAGG + Intergenic
963249267 3:143087600-143087622 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
963282453 3:143398101-143398123 GTGGTGGTAAGGTGGTGGCGGGG - Intronic
963742958 3:149097926-149097948 GTGGGGAGGGGGAGGGGGAGGGG + Intergenic
963837734 3:150074071-150074093 GTGTGGAGAGTGAGGTGGTGGGG + Intergenic
964783453 3:160366901-160366923 GGGTTGTGAGGGAGGTGGGGTGG - Intronic
965701202 3:171460505-171460527 GTGGGGAGGCGGAGGAGGCGTGG + Intergenic
966912718 3:184568596-184568618 GAGGTGAGGGGGATGTGGGGGGG - Intronic
966967104 3:185004492-185004514 GTGGGGAGAGGGAGACCGCGGGG + Intronic
967524094 3:190472685-190472707 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
967858352 3:194134552-194134574 GCGGGGAGAGGGCGGGGGCGAGG + Intergenic
968084794 3:195869439-195869461 GGAGTGAGAGAGAGGGGGCGGGG + Intronic
968202000 3:196762673-196762695 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
968226076 3:196973233-196973255 GTGGGGAGAGGGAGAGGGCGAGG - Intergenic
968299713 3:197603206-197603228 GTGGGGAGAGGGAGCGGGAGAGG + Intergenic
968411479 4:394975-394997 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
968592413 4:1465675-1465697 GTGCTGAGGAGGAGGAGGCGGGG + Intergenic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968713732 4:2139187-2139209 GTGGGGAGAGGGAGGAGCCACGG + Intronic
968924483 4:3539736-3539758 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
968950431 4:3688648-3688670 ATGGTGAGCAGGAGGTGGCTAGG + Intergenic
969213277 4:5704325-5704347 TTGGGGAGAGGGAGGAGGCAAGG + Intronic
969355229 4:6621121-6621143 GGGGTGAGAGGGAGGCTGGGAGG + Intronic
969403983 4:6977070-6977092 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
969469427 4:7378769-7378791 GTGGTCTGAGGGAGGTGGGCAGG - Intronic
969607777 4:8211135-8211157 GGGGGGAGAGGGAGGTAGAGGGG - Intronic
969607812 4:8211234-8211256 GTGGGGAGAGGGAGGGAGAGGGG - Intronic
969608506 4:8214199-8214221 GTGCTGAGGGGGAGGTGTAGAGG + Intronic
969631569 4:8341683-8341705 GTGGTGAGGGGGACGTGGAGGGG + Intergenic
970171427 4:13294993-13295015 AGGGTGAGAGGGAGGAGGGGAGG - Intergenic
970216281 4:13762126-13762148 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
970223804 4:13836661-13836683 GGGGTGAGAGGCAGATGGAGGGG + Intergenic
970617258 4:17780215-17780237 GAAGTGAGAGGGAGATGGTGAGG + Intronic
971248209 4:24949429-24949451 GTGGTGGCAGGGAGGGGGGGTGG + Intronic
971395343 4:26221936-26221958 GCGGTGAGAGGGATGGGGGGAGG + Intronic
971595017 4:28515790-28515812 GTGGGGAGAGGGAGAGGGCGAGG + Intergenic
971923646 4:32977187-32977209 GTAGTGAGGGGGAGGTGGTAAGG + Intergenic
971973513 4:33652552-33652574 GTGGTCACAGGGAGGAGGAGAGG + Intergenic
972304569 4:37819814-37819836 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
972390764 4:38610871-38610893 GTGGGGAGGAGGAGGTGGTGTGG - Intergenic
972552811 4:40148463-40148485 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
972778652 4:42266241-42266263 GTGGGGAGTGGAAGGTGGTGGGG - Intergenic
973108928 4:46376755-46376777 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
973593244 4:52464123-52464145 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
973650259 4:52991984-52992006 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
973650275 4:52992035-52992057 GTGGGGAGAGGGAGACTGCGGGG - Intronic
973733819 4:53850389-53850411 CACGTGAGAGAGAGGTGGCGAGG + Intronic
973844785 4:54900681-54900703 GTGGGAAGAGGGAGGTGGTGGGG + Intergenic
974021388 4:56694300-56694322 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
975151272 4:71023804-71023826 GTGGGGAGTGGGAGGTTGGGAGG - Intronic
975779156 4:77820294-77820316 GGGGTGAGGGGAAGGAGGCGGGG + Intergenic
975840439 4:78468252-78468274 GTGGTGAGAGAGAGGGGTCCAGG + Intronic
975848197 4:78547322-78547344 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
976149254 4:82077099-82077121 GTGGGGAGAGGGAGATGGAGAGG - Intergenic
977307957 4:95348974-95348996 GTAGTGAGAGGGAGGGCGGGAGG + Intronic
978014106 4:103722669-103722691 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
978014111 4:103722686-103722708 GTGGGGAGAGGGAGACGGTGGGG - Intergenic
978660778 4:111123663-111123685 GTGGGGAGAGGGGGGGGGTGGGG + Intergenic
978692404 4:111529669-111529691 GTGGTGGGAGGGAAGTGAGGGGG + Intergenic
978954693 4:114599144-114599166 GTGGTTAGTGGGGGTTGGCGGGG + Intronic
979622193 4:122811158-122811180 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
980394473 4:132192519-132192541 TTGGTGAGAGTAAGGTGGGGAGG + Intergenic
980687108 4:136242597-136242619 GTAGTGAGAGGCTGGTGGGGAGG + Intergenic
981538495 4:145824637-145824659 CTGGTGAGAGGTAGGGGGAGGGG - Intronic
981970248 4:150658756-150658778 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
982173325 4:152682451-152682473 GTGGTGGTGGGGAGGGGGCGGGG - Intergenic
982821106 4:159940650-159940672 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
983460836 4:168024041-168024063 GTTGTGGGAGGGAGCTGGTGGGG - Intergenic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
983535841 4:168855991-168856013 GGGGAGAGAAGGAGGTGGGGAGG - Intronic
983646379 4:169996001-169996023 GTGGGGGGTGGGGGGTGGCGGGG - Intronic
984296717 4:177862560-177862582 GTGGTGAGCGGAGGGTGGGGGGG - Intronic
984813889 4:183819557-183819579 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
984905164 4:184619678-184619700 GAGGAGAGAGGGAGTGGGCGAGG + Intergenic
984977375 4:185241505-185241527 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
985247412 4:187992015-187992037 GTGGGGAGAGGGAGACGGAGAGG + Intergenic
985835856 5:2271575-2271597 GTGAGGGGAGGGAGGTGGTGAGG + Intergenic
985835895 5:2271694-2271716 GTGAGGGGAGGGAGGTGGTGAGG + Intergenic
985835902 5:2271711-2271733 GTGAGGGGAGGGAGGTGGTGAGG + Intergenic
986006505 5:3672902-3672924 GTGGAGGGAGGGAGGTGACTGGG + Intergenic
986314686 5:6578744-6578766 GTGGTGACATGGAGGTGACTCGG - Intergenic
986624709 5:9712917-9712939 GTGGTGTGAGGAAGGTGGGAGGG - Intergenic
987268176 5:16277861-16277883 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
987373903 5:17217437-17217459 GTGGGGAGATGGAGCTGGAGGGG + Intronic
987469117 5:18308967-18308989 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
988544155 5:32141582-32141604 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
989061769 5:37416544-37416566 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
989068328 5:37484567-37484589 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
989076194 5:37564556-37564578 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
989211734 5:38863174-38863196 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
989212162 5:38866710-38866732 CTGATGAGAGGGAGGGGGCGGGG + Intronic
989574864 5:42979816-42979838 ATGGAGAGAGGGAGGGGGAGGGG - Intergenic
989583853 5:43058890-43058912 TTGGTGAGGGGGATGTGGCAGGG - Intergenic
990289177 5:54331316-54331338 GTGGTGGGCGGGGGGTGGGGGGG - Intergenic
990485901 5:56258846-56258868 GGGGAGAGAGGGAGGGGGAGGGG + Intergenic
990498428 5:56371917-56371939 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
991672796 5:69063817-69063839 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
991932332 5:71765966-71765988 GCGGTGAGAAGGAGGTGGTGTGG + Intergenic
992289387 5:75269403-75269425 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
992442800 5:76811588-76811610 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
992558639 5:77928471-77928493 GGGGGGAGAGGGAGGTAGAGAGG + Intergenic
992801578 5:80300554-80300576 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
992964372 5:81984414-81984436 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
993022862 5:82612590-82612612 GGGGTGGGAGGGTGGTGGAGAGG + Intergenic
993496440 5:88615219-88615241 GTGGGGAGAGGGAGCGGGAGAGG - Intergenic
993503258 5:88684856-88684878 GAGGAGAGAGGGAGGGGGAGAGG + Intergenic
993901140 5:93584908-93584930 GGGGGGAGGGGGAGGGGGCGGGG - Exonic
994406490 5:99352160-99352182 GTGGTGAGTGGTAAGTGGAGAGG + Intergenic
995162027 5:108993568-108993590 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
995193116 5:109340659-109340681 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
995236412 5:109833688-109833710 GTGGGGAGGGGGAGGGGGAGGGG + Intronic
995600263 5:113788468-113788490 GTGGTAAGAGGAAGGAGGGGCGG + Intergenic
995818251 5:116196345-116196367 GTGAAGAGAGGGAGGGGGTGAGG + Intronic
995942531 5:117600796-117600818 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
996053957 5:118964423-118964445 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
996057560 5:118998500-118998522 GTGCGGAGAGGGAGGCGGAGGGG - Intergenic
996386452 5:122914122-122914144 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
997878862 5:137572268-137572290 GTGGTGATGGGGAGGTGATGAGG - Intronic
998022040 5:138777870-138777892 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
998025475 5:138811931-138811953 GTGGGGAGAGGGAGAGGGAGGGG + Intronic
998239661 5:140428648-140428670 GTGGGGAGAGGGAGAGGGCGAGG + Intronic
998451990 5:142241902-142241924 GTGGTGGGGGGTGGGTGGCGGGG - Intergenic
998507788 5:142686093-142686115 GTGGGGAGAGGGACGGGCCGTGG + Intronic
998743037 5:145226614-145226636 GAGGGGAGAGGGAGGAGGCAAGG - Intergenic
998819707 5:146047593-146047615 GTGGGCACAGGGAGGTGGGGAGG - Intronic
998836087 5:146203884-146203906 GTGGGGGAGGGGAGGTGGCGTGG + Intronic
999152924 5:149438451-149438473 GTGGTGGGATGGAGGCGGAGTGG + Intergenic
999181307 5:149671408-149671430 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
999455825 5:151714858-151714880 GTGGGGAGAGGGAGGGGGAGGGG + Intergenic
999532826 5:152480822-152480844 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
999652370 5:153779937-153779959 GTGGTGAAAGCGAGGTGGCAGGG + Intronic
999687812 5:154118088-154118110 ATGATGAGCGGGAGGTGGCTAGG - Intronic
999986825 5:157013497-157013519 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
999986835 5:157013526-157013548 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1000158973 5:158581766-158581788 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1000233263 5:159335031-159335053 GTGGTGGGCGGGGAGTGGCGGGG - Intergenic
1001420176 5:171580161-171580183 GTGGTGAGTGGGAGGGAGCAGGG - Intergenic
1001720764 5:173855285-173855307 GTGGTTAGAGGGAGGAAGAGAGG - Intergenic
1001741691 5:174058155-174058177 ATGTTGAGAGTGAGGTGGCTGGG + Intronic
1001897201 5:175392683-175392705 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897213 5:175392716-175392738 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897225 5:175392749-175392771 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897237 5:175392782-175392804 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897249 5:175392815-175392837 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897261 5:175392848-175392870 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897273 5:175392881-175392903 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897285 5:175392914-175392936 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897297 5:175392947-175392969 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897309 5:175392980-175393002 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897321 5:175393013-175393035 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897333 5:175393046-175393068 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897345 5:175393079-175393101 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897357 5:175393112-175393134 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897369 5:175393145-175393167 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897379 5:175393178-175393200 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897393 5:175393213-175393235 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897404 5:175393247-175393269 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001993370 5:176134864-176134886 CTGCTGAGGGGGAGGTGGTGGGG + Intergenic
1002060310 5:176621728-176621750 GGGATGAGTGGAAGGTGGCGGGG - Intronic
1002193272 5:177489751-177489773 CTGGTGAGAGGGAGTGGGCTCGG - Exonic
1002417214 5:179126833-179126855 GTGGTGGCAGGGCGGTGGAGGGG + Intronic
1002658398 5:180771769-180771791 GTGGAGAGAGGGAGACGGAGAGG + Intergenic
1003407612 6:5836660-5836682 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1004367145 6:15022006-15022028 GGGGTGAGAGGGAGAGGGAGGGG - Intergenic
1004415168 6:15416700-15416722 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1004874170 6:19938672-19938694 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1005048968 6:21666355-21666377 GCGGGGAGAGGGAGGGGGCGGGG + Intergenic
1005063384 6:21797066-21797088 GGGGAGAGAGGGAGATGGGGGGG - Intergenic
1005063457 6:21797246-21797268 CGGGAGAGAGGGAGGTGGGGGGG - Intergenic
1005063771 6:21798383-21798405 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1005069684 6:21851756-21851778 GTGAGGAGAGGGAGGTGGGGGGG - Intergenic
1005744656 6:28825224-28825246 GCGGAGAGAGGGAAGAGGCGGGG + Intergenic
1005929654 6:30474465-30474487 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
1006014340 6:31068059-31068081 GTGGGGAGAGGGAGGGGGAGAGG + Intergenic
1006014368 6:31068129-31068151 GTGGGGAGAGGGAGAGGGAGGGG + Intergenic
1006014380 6:31068164-31068186 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1006258875 6:32852575-32852597 ATGGTGAGGGGGAGGAGGCGTGG - Intronic
1006282063 6:33060765-33060787 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1006424293 6:33954629-33954651 ATGGGGAGAGGGTGGTGGCTGGG - Intergenic
1006461816 6:34163730-34163752 GTGGTTGGAGGGAGGAGGCGCGG - Intergenic
1006617385 6:35339735-35339757 GTGGGGAGAGGGAGCGGGGGAGG - Intergenic
1006640134 6:35485576-35485598 GTGGAGAGAGTGGGGTGGAGAGG - Intronic
1006689027 6:35863619-35863641 ATGGGGAGGGGGAGGTGGAGGGG + Intronic
1006904777 6:37525856-37525878 GTGGGTGGAGGGAGATGGCGGGG + Intergenic
1006945034 6:37779257-37779279 GTGGAGAGAGGGAGGAAGTGGGG + Intergenic
1007210181 6:40187399-40187421 GGGGTGAGGGGGTGGTGGTGGGG + Intergenic
1007521644 6:42454644-42454666 GTGCTGGGAGGGAGGTGGAGGGG - Intergenic
1007651337 6:43424620-43424642 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
1007837247 6:44683154-44683176 GGGGAGAGATGGAAGTGGCGAGG - Intergenic
1008184509 6:48372073-48372095 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1008555881 6:52672526-52672548 GTGGGAAGAGGGAGGTGGCTAGG - Intronic
1009048913 6:58257107-58257129 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1009166201 6:60344858-60344880 GTGGGGTGAGGGAAGTGGGGAGG - Intergenic
1009687982 6:66987980-66988002 GTGGTGAGTGTTAGGTGGCATGG + Intergenic
1010142120 6:72623131-72623153 GTGGTGGCTGGGTGGTGGCGAGG - Intronic
1010187300 6:73158138-73158160 CTGGTGCGGGGGAGGGGGCGGGG + Intronic
1010300788 6:74255969-74255991 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1010400773 6:75442741-75442763 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1010727843 6:79355511-79355533 GTGGTGAGAGAGAGTGGGGGCGG + Intergenic
1011297072 6:85837932-85837954 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1011351777 6:86432096-86432118 GTGATGAGAGGGTGGTGACATGG + Intergenic
1011474384 6:87736833-87736855 GTGGGGAGAGGGAGGGGGAGGGG + Intergenic
1012132842 6:95518914-95518936 GTGGCGAGAGGCGGGTGGGGAGG + Intergenic
1012498794 6:99865272-99865294 TTGGTGTGAGGGATGGGGCGGGG + Intergenic
1012899763 6:104991997-104992019 GTGGAAAGAGGGAGGGGGAGGGG + Intronic
1013169594 6:107624533-107624555 GAAGTGACAGGGAGGTGGAGTGG + Intronic
1013190738 6:107802727-107802749 GTGGGGAGAGGGAGAGGGAGGGG - Intronic
1013219352 6:108063678-108063700 GTGGTGTGTGGCAGGCGGCGGGG - Intronic
1013325824 6:109046102-109046124 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1013642992 6:112106397-112106419 GTGGTGAGGGGGGAGTGGGGAGG + Intergenic
1013651352 6:112198201-112198223 GTGGTGAAGGGGAGTTGGGGAGG + Intronic
1013837004 6:114344389-114344411 GTGGTGGGAGGAAGGAGGTGGGG - Intergenic
1014123260 6:117750372-117750394 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1014771279 6:125460014-125460036 GGAGTGAGAGTGAGGTGGGGAGG + Intergenic
1015149188 6:130019687-130019709 TTGGGAAGAGGGAGGCGGCGAGG - Intronic
1015871323 6:137779277-137779299 GTGGTGAGAAGGATGGAGCGTGG + Intergenic
1016047944 6:139499680-139499702 ATGGGGAGTGGGAGGCGGCGGGG - Intergenic
1016123828 6:140374764-140374786 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1016554619 6:145322670-145322692 GTGGGGTGAGGGAGGTGGGAGGG - Intergenic
1016802364 6:148179713-148179735 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1016923393 6:149317641-149317663 GGGGGCAGAGGGAGGTGGGGAGG + Intronic
1016973779 6:149787301-149787323 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1017671098 6:156770351-156770373 GTGCTGAGAGGGAGCAGGAGAGG - Intergenic
1017851706 6:158309901-158309923 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1018158204 6:161009859-161009881 GTCGGGGGAAGGAGGTGGCGGGG + Intronic
1018528315 6:164737021-164737043 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1018528324 6:164737050-164737072 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1018651530 6:165995762-165995784 GGGGTGGGAGGGAGATGGAGTGG - Intergenic
1018928390 6:168222786-168222808 AAGGGGAGAGGGTGGTGGCGGGG + Intergenic
1018948469 6:168363404-168363426 ATGGGGAGAGGGAGATGGAGGGG + Intergenic
1018985891 6:168636929-168636951 GAGGGAAGAGGGAGGTGGGGAGG - Intronic
1019061757 6:169262453-169262475 CTGGAAAGAGGGAGGTGGGGAGG - Intergenic
1019531624 7:1506380-1506402 ATGAGGAGAGGCAGGTGGCGGGG - Intergenic
1019718673 7:2555096-2555118 GGGGGGAGAGGGGGGCGGCGGGG + Intronic
1020014069 7:4820865-4820887 GTGGTGAGAGGGAGGTGGCGGGG - Intronic
1020034691 7:4958010-4958032 GTGGTGAGTGGGAGATGGGCTGG - Intronic
1020131966 7:5563682-5563704 ATGGTGCGAGGGAGGGCGCGCGG - Intronic
1020235681 7:6353530-6353552 GAGGTGGGAGGGAGGGAGCGAGG + Intergenic
1020326188 7:6976123-6976145 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1020381988 7:7557212-7557234 GTGGTGGTGGGGAGGTGGGGTGG - Intergenic
1021492969 7:21239935-21239957 TTAGTGAGAGGGAGGTTGGGGGG - Intergenic
1021735141 7:23635878-23635900 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1021991705 7:26147479-26147501 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1022234143 7:28444993-28445015 GTGGTGGGAGGGAGCTGGTAGGG + Intronic
1022338258 7:29443741-29443763 GGGGTGAGAGAGAGATGGCAGGG + Intronic
1022343339 7:29488682-29488704 GGGGTCAGGGGGAGGTGGGGGGG - Intronic
1022487264 7:30789254-30789276 GTGGTGTGAGGGAGATGGCTTGG + Intronic
1022491940 7:30827469-30827491 GTGGTTAGAGGGATGTGGAAGGG - Intronic
1022497030 7:30859769-30859791 GTGGTGAATGGGCGGTGGCCAGG + Intronic
1022813051 7:33887845-33887867 GTGCTGAGAGGGTGGTGATGTGG - Intergenic
1023735178 7:43229479-43229501 GTGGAGAGTGGGAGGGGGAGGGG + Intronic
1023879802 7:44311994-44312016 GTGGGGACAGAGATGTGGCGAGG - Intronic
1024291425 7:47807374-47807396 GGGGTGAGAGGGAGGTTGTGGGG + Intronic
1024309662 7:47958788-47958810 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1024471448 7:49771861-49771883 GTGATGAGAGGCAGGTGGGTGGG + Intergenic
1024607439 7:51034082-51034104 GTGGTGGGAGGGAGCTGGACAGG - Intronic
1024744859 7:52394292-52394314 GGGGAAAGAGGGAGGGGGCGAGG - Intergenic
1025000412 7:55311205-55311227 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1025184594 7:56847651-56847673 GTGGGAAGGGGGAGGTGGAGGGG - Intergenic
1025687335 7:63729317-63729339 GTGGGAAGGGGGAGGTGGAGGGG + Intergenic
1025800659 7:64784119-64784141 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1025803837 7:64810434-64810456 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1025828807 7:65032922-65032944 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1026451953 7:70537171-70537193 CTGGTGGGAAGGAGGTGGAGGGG - Intronic
1026862259 7:73798094-73798116 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1026868038 7:73835207-73835229 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1026988794 7:74571303-74571325 GTCATGAGTGGGAGGTGGTGAGG + Intronic
1027025790 7:74851164-74851186 GAGGTGTGAGGGTGGGGGCGGGG - Intronic
1027061971 7:75092955-75092977 GAGGTGTGAGGGTGGGGGCGGGG + Intronic
1027183122 7:75953306-75953328 GTGGAAAGAGGGAGGGGGAGGGG + Intronic
1028480120 7:91295110-91295132 GTGGTGAGGGGGAGAGGGTGGGG + Intergenic
1029279253 7:99426116-99426138 ATGGGGAGAGGGAGGGGGAGAGG - Intronic
1029279267 7:99426151-99426173 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1029334768 7:99889238-99889260 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1029525539 7:101091765-101091787 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1031101583 7:117486875-117486897 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1031797108 7:126188550-126188572 GGGGTGAGAGGGAAATGGGGAGG - Intergenic
1031830449 7:126619373-126619395 GTGGGGTGAGGGAAGTGGGGAGG + Intronic
1032012619 7:128356824-128356846 GTGGGGAGAGGGATGGGGCCAGG - Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032157087 7:129477185-129477207 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1032243840 7:130189979-130190001 GTGGTGCTAGAAAGGTGGCGCGG + Intronic
1032290899 7:130590193-130590215 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1033024596 7:137760278-137760300 GAGGAGAGAGGGAGGTGGAATGG - Intronic
1033112553 7:138594358-138594380 GGTGTGAGAGGGAGATGGTGGGG - Intronic
1033220376 7:139523600-139523622 GGGCGGAGAGGGAGGAGGCGCGG - Intergenic
1033266818 7:139894190-139894212 GTGGTGCGTGGGTGGTGGCACGG - Intronic
1033332946 7:140430962-140430984 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1034035942 7:147822194-147822216 GTGTTGGGAGTGAGGTGGGGAGG - Intronic
1034454340 7:151158211-151158233 GTTGTGGGAGTGAGGTGGAGAGG - Intronic
1034723726 7:153316204-153316226 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1035251406 7:157599892-157599914 GTGGAGAGGGGCAGGTGGAGAGG - Intronic
1035295106 7:157862802-157862824 GTGGTGTGCGGGAAGCGGCGAGG + Intronic
1035398963 7:158552287-158552309 GTGGTTAGGAGGCGGTGGCGGGG - Intronic
1035402764 7:158577901-158577923 AAGGGGAGAGGGAGGTGGCCGGG - Intronic
1035544864 8:472511-472533 GTGGTGGGTGGCAGGTGGGGTGG - Intergenic
1036788964 8:11705057-11705079 GTGGGCAGAGGGGGGTGCCGGGG + Intronic
1037409855 8:18584904-18584926 GTGGTGAGAGGGAGAGGGAGCGG + Intronic
1037674785 8:21043458-21043480 GAGGTCAGGGGGAGGTGGGGTGG - Intergenic
1037674886 8:21043671-21043693 GAGGTCAGGGGGAGGTGGGGTGG - Intergenic
1037674905 8:21043714-21043736 GAGGTCAGGGGGAGGTGGGGTGG - Intergenic
1038045337 8:23761291-23761313 GTGGTGAAATGGGGGTGGCGGGG + Intergenic
1038270651 8:26072613-26072635 GTGGAGGGTGGGAGGTGGGGAGG - Intergenic
1038403480 8:27304504-27304526 GTGCTGAGACAGAGGTGGCCAGG - Intronic
1038568172 8:28637016-28637038 GCGGGGAGAGGGAGGGAGCGGGG + Intronic
1038574813 8:28695810-28695832 GTGGTGATGGGGAGGAGGTGGGG + Intronic
1039091391 8:33833404-33833426 GTGAAGGGAGGGAGGAGGCGAGG + Intergenic
1039270382 8:35874246-35874268 GACGGGAGAGGGAGGTGGCGGGG - Intergenic
1039400256 8:37263086-37263108 GTGGTTTGAGGGAGCTGGGGAGG + Intergenic
1039488021 8:37927082-37927104 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1039881366 8:41627278-41627300 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1039884851 8:41649040-41649062 GTGGTGTGTGGGATGTGGAGAGG + Intronic
1040093541 8:43420504-43420526 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1040388819 8:46932764-46932786 CAGGTGGGAAGGAGGTGGCGAGG - Intergenic
1040426858 8:47297599-47297621 GTGGGGTGGGGGAGGTGGGGAGG - Intronic
1040444341 8:47478277-47478299 GTGGTGACAGCGTGGTGGGGAGG + Intronic
1040785305 8:51158400-51158422 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1041172290 8:55156423-55156445 GTGGGGAGAGGGAGGAAGGGCGG + Intronic
1041287170 8:56272995-56273017 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1042048395 8:64680986-64681008 CTGGTGAGGGGCAGGTGGAGTGG - Intronic
1042303368 8:67310097-67310119 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1043637496 8:82404720-82404742 GTAGTGGGAGGGGGGTGGGGGGG - Intergenic
1043961776 8:86424817-86424839 GTGGGGAGAGGGAGAGGGAGGGG + Intronic
1044223515 8:89698160-89698182 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1044891537 8:96841143-96841165 GTCGGGAGAGGGAGCTGGCTTGG + Intronic
1045195485 8:99926593-99926615 GTGGGGAGAGGGAGAGGGAGGGG - Intergenic
1045365459 8:101471603-101471625 GTGGTGGCAGTGAGGTGGGGGGG + Intergenic
1045569098 8:103351423-103351445 GTGGTGAAGGGCAGTTGGCGTGG + Intergenic
1046696370 8:117344256-117344278 GGGGTAAGAGGGATTTGGCGAGG - Intergenic
1047319333 8:123764926-123764948 GAGGTTAGAGGGAGGTTGAGGGG + Intergenic
1047594705 8:126366509-126366531 GTGGGGTGACGGGGGTGGCGGGG - Intergenic
1048499282 8:134960968-134960990 GTGGTGAATAGGAGGTGGGGAGG + Intergenic
1048958442 8:139555991-139556013 GTGGTGGGATAGAGGTGGGGTGG - Intergenic
1049177590 8:141203162-141203184 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049177600 8:141203197-141203219 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049217760 8:141415663-141415685 GTGGTGAAGGGTAGGGGGCGTGG + Intronic
1049361197 8:142213205-142213227 GGGGAGAGAGGGAGGCGGAGGGG - Intronic
1049545386 8:143228391-143228413 GGGGGGAGAGGGAGGCGGGGGGG + Intergenic
1049610484 8:143552798-143552820 GGGGGGATAGGGAGGTGGGGTGG + Intergenic
1049654122 8:143790300-143790322 GTGGGGCTAGGGAGGTGGGGTGG - Intergenic
1049664358 8:143836430-143836452 GTGGGGAAAGGGAGGTTGGGCGG + Intronic
1049690926 8:143958538-143958560 GAGGTGAAAGGGTGGTGGCCAGG - Intronic
1050119734 9:2296001-2296023 GTGGTGAGAGAAAGCTGGCCTGG - Intergenic
1051068822 9:13137552-13137574 GTGATGAGGGTGAGGTGGGGTGG - Intronic
1051109033 9:13614360-13614382 GTGGTGACAGGGATGCGGGGTGG + Intergenic
1051276684 9:15405820-15405842 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1051347179 9:16162651-16162673 TTGGTGGGGGGGAGGGGGCGGGG + Intergenic
1051430809 9:16978343-16978365 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1051726181 9:20089684-20089706 GTGGTGGGCAGGGGGTGGCGGGG - Intergenic
1052274375 9:26661028-26661050 GTGGTGAGAGGGAGAGAGAGTGG + Intergenic
1052531188 9:29686307-29686329 GAGGGGAGAGGGAGGAGGAGGGG + Intergenic
1053047940 9:34936052-34936074 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1053467832 9:38324019-38324041 GTGGGGAGAGGGAGACGGAGAGG - Intergenic
1053665532 9:40314894-40314916 GTGGTGGGAGGGTGGTGGGTGGG + Intronic
1053835484 9:42130120-42130142 GAGGTGGGAGGCAGGGGGCGGGG + Intergenic
1053915115 9:42939941-42939963 GTGGTGTGAGGGTGGTGGGTGGG + Intergenic
1054376685 9:64454924-64454946 GTGGTGGGAGGGTGGTGGGTGGG + Intergenic
1054519082 9:66061390-66061412 GTGGTGGGAGGGTGGTGGGTGGG - Intergenic
1054926943 9:70599107-70599129 GTGGTGAGAAGTAGTTGGCTAGG - Intronic
1055137718 9:72842348-72842370 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1055270103 9:74548170-74548192 GTGGGGAGAGGGTGAGGGCGGGG + Intronic
1055314708 9:75022717-75022739 ATGGTGAGAGGGAAGTTGTGGGG - Intronic
1055519058 9:77061615-77061637 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1055934055 9:81588718-81588740 ATGCTGAGAGGAAGGTGGTGGGG + Intronic
1056103557 9:83324342-83324364 GAGGAGAGAGGGAGGTGGTCTGG + Intronic
1056233313 9:84568717-84568739 GGCCTGAGAGGGAGGTGGGGAGG + Intergenic
1056564585 9:87759906-87759928 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1056625050 9:88245972-88245994 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1056802352 9:89701478-89701500 GCGGTGGGTGGGAGGTGGAGGGG - Intergenic
1057223023 9:93267944-93267966 GTGGTGAGAGTGCAGTGGCTGGG + Intronic
1057716359 9:97498911-97498933 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1058018671 9:100067174-100067196 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1058512186 9:105731446-105731468 GGGGTGAGAGGGAGGGGGAAGGG - Intronic
1058566682 9:106293088-106293110 CTGCAGAGAAGGAGGTGGCGTGG + Intergenic
1058781394 9:108339529-108339551 GGGGTGGGAGGGAGGGGGTGGGG + Intergenic
1059264418 9:113012622-113012644 GTGTTGAGGGGACGGTGGCGGGG + Intergenic
1059368627 9:113807169-113807191 CTGGTCAGAGGGAAGTGGGGTGG - Intergenic
1059755666 9:117291250-117291272 GTGGAGAGATGGAGGGGGCGGGG - Intronic
1059774590 9:117462790-117462812 ATGATGAGAGGGAGGTGGCTGGG - Intergenic
1060298446 9:122359368-122359390 GCTGGGAGAGGGAGGTGGGGAGG - Intergenic
1060334640 9:122710772-122710794 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060625395 9:125107815-125107837 GTGGGGAGAGGGAGATGGAGAGG - Intronic
1060651300 9:125329110-125329132 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1060669966 9:125459852-125459874 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1060682157 9:125576485-125576507 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1060907338 9:127318663-127318685 GAGATGAGAGGGAGGTGGGAGGG - Intronic
1060947546 9:127579083-127579105 GAGGTGGGAGGGAGGTGGTGGGG - Intergenic
1061176573 9:129001270-129001292 GAGGTGGGAGGGAAGAGGCGGGG + Intronic
1061496436 9:130977557-130977579 GTGCTGCGAGTGAGGTGGAGAGG + Intergenic
1061572390 9:131485801-131485823 TTGGTGAGTGGGAGGTGGGAAGG + Intronic
1061635651 9:131907202-131907224 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1061650253 9:132042060-132042082 GTGGAGACAGGCAGGTGGCGGGG + Intronic
1061678356 9:132230760-132230782 GTGGAGGGGGGGAGGTGGAGGGG - Intronic
1061881684 9:133572168-133572190 GTGGGGGGTGGGGGGTGGCGGGG - Intronic
1061961332 9:133990777-133990799 GTGGTCAGGTGCAGGTGGCGGGG - Intronic
1062100204 9:134724021-134724043 GTGGTGCGAGGCAGGGGCCGAGG - Intronic
1062127374 9:134870807-134870829 GGGGTGGGAGGGAGGTGGGAGGG + Intergenic
1062166570 9:135110752-135110774 GTGGTGGGAAAGAGGTGGGGGGG - Intronic
1062392665 9:136340173-136340195 GTGTGCAGAGGGAGGTGGCGTGG - Intronic
1062495460 9:136829482-136829504 GTGGTAAGAGGGAGCTGGCGGGG + Exonic
1203562459 Un_KI270744v1:70760-70782 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1185432721 X:18928-18950 GTGGTGAGCGGGAGGTCTCGAGG - Intergenic
1185440786 X:226632-226654 GTGGTGAGCGGGAGGTCTCGAGG - Intergenic
1185442072 X:231750-231772 GTGGTGAGCGGGAGGTCTCGAGG - Intergenic
1185598885 X:1325447-1325469 GGGGAGAGAGGGAGGTGGGGAGG + Intergenic
1185828625 X:3276954-3276976 GTGGTGAGAGAGAGAGGGTGGGG - Intronic
1186245319 X:7610308-7610330 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1187118941 X:16384523-16384545 GAGGAGAGAGGGAGGGGGCAGGG - Intergenic
1187183877 X:16966122-16966144 GTGGGGAGAGGGAGAGGGCTGGG + Intronic
1187468128 X:19543889-19543911 GAGCTGGGAGGCAGGTGGCGAGG + Intronic
1188054974 X:25530399-25530421 GTGGGGAGAGGGAGGTGGTCAGG + Intergenic
1188308337 X:28586425-28586447 GTGGGGAGTGGGAGGAGGAGCGG - Intergenic
1188552264 X:31377159-31377181 GAGTAGAGCGGGAGGTGGCGGGG + Intronic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1188994150 X:36861731-36861753 CTGGAGACAGGGAGGTGGCTGGG - Intergenic
1189021982 X:37350053-37350075 GGGGGGAGGGGGAGGCGGCGTGG + Intronic
1189057037 X:37708218-37708240 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1189125247 X:38438588-38438610 ATGGTGAGAGAGAGGTGGTTAGG - Intronic
1189547834 X:42060889-42060911 GAGGAGAGAGGGAGGGGGCTAGG - Intergenic
1189570202 X:42286630-42286652 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1189881873 X:45502603-45502625 GTGGTGGTGGGGAGGTGACGGGG + Intergenic
1189968781 X:46397011-46397033 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1190184361 X:48221772-48221794 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1190793447 X:53721115-53721137 GTGGGGAGAGGGGGATGGGGAGG - Intergenic
1190839355 X:54130067-54130089 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1190839365 X:54130096-54130118 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1190839377 X:54130131-54130153 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1190914651 X:54802152-54802174 GGGGTGGGAGGGAGATGGGGAGG + Intergenic
1191009693 X:55747828-55747850 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1191637181 X:63392395-63392417 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1192184631 X:68938751-68938773 GTGGTAAGAGGGAGGGGGAGAGG + Intergenic
1192386637 X:70678951-70678973 GTGGGGAGAGGGAGAGGGAGAGG - Intronic
1192464261 X:71342553-71342575 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1192553991 X:72075863-72075885 GCGGTGAGAGGGATGTGGAGGGG + Intergenic
1192610071 X:72559049-72559071 GTGGGGAGGGGGAGGGGGGGAGG - Intronic
1192813682 X:74569822-74569844 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1192970074 X:76219197-76219219 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1193067887 X:77278669-77278691 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1193132593 X:77932917-77932939 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1193600504 X:83504297-83504319 GTGGGGAGAGGAAGGTGGTTTGG - Intergenic
1194855389 X:98921475-98921497 GTGGTGATGGGGGGGTGGTGGGG - Intergenic
1195257711 X:103105292-103105314 GTGGGGAGAGGGAGAGGGAGAGG + Intergenic
1197735745 X:129849765-129849787 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1197749790 X:129956811-129956833 GGGGTGGGGGGGAGGTGGGGAGG - Intergenic
1197753365 X:129980300-129980322 GCGGGAGGAGGGAGGTGGCGGGG - Intergenic
1198246681 X:134838677-134838699 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
1198301697 X:135339742-135339764 GTGGAGCGAGGGAGGGGGCTGGG - Intronic
1198791782 X:140354341-140354363 GTGGGGAGTGGGGGGTGGGGCGG - Intergenic
1198867242 X:141137303-141137325 GGGGTGAGAATGAGGTGGCAAGG + Intergenic
1199017848 X:142840186-142840208 GTGATGAGAGGGAAGTGGAATGG - Intergenic
1199230781 X:145435559-145435581 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1199452883 X:147993393-147993415 GTGGGGAGAGGGAGAGGGAGAGG + Intronic
1199474493 X:148230925-148230947 GTGGAGAGAGGGAGGGGGATGGG - Intergenic
1199586262 X:149420122-149420144 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1199814646 X:151386851-151386873 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1200022932 X:153226751-153226773 GTGATGAGAGGGAGGGGGTGTGG + Intergenic
1200063627 X:153494751-153494773 GTGGTGGGGGCGAGGGGGCGGGG + Intronic
1200085463 X:153602218-153602240 ATGGTGACAGGGAGCTGGCTCGG - Intergenic
1200206759 X:154321863-154321885 GTGGCCAGAGAGAGGAGGCGCGG + Intronic
1200774786 Y:7160525-7160547 TGGGGGGGAGGGAGGTGGCGGGG + Intergenic
1201016900 Y:9613788-9613810 GTGGGGGGAGGGAGGTGGGTGGG - Intergenic
1201077379 Y:10197971-10197993 GTGCTGAGAGGCAAGGGGCGGGG - Intergenic
1201270892 Y:12252741-12252763 GTGGGGGGATGGAAGTGGCGGGG - Intergenic
1201335630 Y:12878116-12878138 GTGGGGAGAGGGAGAGGGAGAGG - Intergenic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic
1201906198 Y:19087785-19087807 GTGGAGAGATGGAGGGGGCAAGG - Intergenic