ID: 1020014867

View in Genome Browser
Species Human (GRCh38)
Location 7:4825044-4825066
Sequence CCGTCCACACAGGCCTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020014867_1020014874 -9 Left 1020014867 7:4825044-4825066 CCTACCCAGGCCTGTGTGGACGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1020014874 7:4825058-4825080 TGTGGACGGAGGAGCAGGTCTGG No data
1020014867_1020014876 0 Left 1020014867 7:4825044-4825066 CCTACCCAGGCCTGTGTGGACGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1020014876 7:4825067-4825089 AGGAGCAGGTCTGGTGGAAAAGG No data
1020014867_1020014875 -6 Left 1020014867 7:4825044-4825066 CCTACCCAGGCCTGTGTGGACGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1020014875 7:4825061-4825083 GGACGGAGGAGCAGGTCTGGTGG No data
1020014867_1020014877 25 Left 1020014867 7:4825044-4825066 CCTACCCAGGCCTGTGTGGACGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1020014877 7:4825092-4825114 AACCCATGTTGTTCTAGAAGAGG 0: 1
1: 0
2: 0
3: 7
4: 126
1020014867_1020014878 26 Left 1020014867 7:4825044-4825066 CCTACCCAGGCCTGTGTGGACGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1020014878 7:4825093-4825115 ACCCATGTTGTTCTAGAAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020014867 Original CRISPR CCGTCCACACAGGCCTGGGT AGG (reversed) Intronic
900487671 1:2931153-2931175 ACTCCCACACAGGCCTGGGAGGG + Intergenic
901018006 1:6242617-6242639 CCGCCCTCCCAGGCCCGGGTCGG + Intergenic
901520217 1:9778003-9778025 CAGTGCCCAAAGGCCTGGGTGGG + Intronic
902918798 1:19654518-19654540 CTGTCCACACAGCCCTGGAGGGG - Intronic
904273808 1:29367447-29367469 GTGGGCACACAGGCCTGGGTGGG - Intergenic
904284216 1:29443633-29443655 CCACCCACAAATGCCTGGGTTGG - Intergenic
904593490 1:31628356-31628378 CCGTCCACAGAGAGCTGGGCTGG - Intronic
904605325 1:31694994-31695016 TCTTCCACACAGTCCTGGCTTGG + Intronic
905119729 1:35672455-35672477 CCTTCCACAAAGTCCAGGGTGGG + Intergenic
915104046 1:153521625-153521647 CAGTCCTCACAGCCCTGGCTCGG + Intergenic
915584200 1:156835053-156835075 CCGACCACACAGGGTTGGGAGGG + Intronic
919763555 1:201112659-201112681 ACTTACACACAGGCCTGGGATGG + Intergenic
919814250 1:201427877-201427899 CCCTCCAGGAAGGCCTGGGTGGG + Intronic
920648643 1:207821163-207821185 CCTTGGACACAGTCCTGGGTGGG - Intergenic
921440712 1:215182588-215182610 CCTCCGTCACAGGCCTGGGTAGG - Intronic
1067299156 10:44993527-44993549 CTGGCCCCTCAGGCCTGGGTCGG - Exonic
1067495568 10:46757364-46757386 GCGCCCACACAGGGGTGGGTAGG - Intergenic
1067599085 10:47583024-47583046 GCGCCCACACAGGGGTGGGTAGG + Intergenic
1067948748 10:50709609-50709631 GCGCCCACACAGGGGTGGGTAGG + Intergenic
1070792409 10:79197172-79197194 CATCCCACAAAGGCCTGGGTTGG - Intronic
1073137458 10:101227868-101227890 CAGGCCGGACAGGCCTGGGTGGG - Intronic
1073145163 10:101275882-101275904 CTGTACCCACAAGCCTGGGTAGG - Intergenic
1075401577 10:122164685-122164707 TCGTCCAAACATGCCTGGGTAGG - Intronic
1076402410 10:130192733-130192755 CCATCCACAGAGACCGGGGTGGG - Intergenic
1076438749 10:130464650-130464672 CACGCCACACAGGCCTGGGCCGG + Intergenic
1076871123 10:133195654-133195676 CAGTACACAGAGGCCTGGGCGGG - Exonic
1076907158 10:133368496-133368518 CCCTTCTCACGGGCCTGGGTGGG + Intronic
1077027015 11:444709-444731 CTGTCCAGATAGGACTGGGTGGG - Intergenic
1077027403 11:447091-447113 CAGTCCACACATGCCTGGGTGGG + Intergenic
1077308928 11:1879997-1880019 CCATCTACACAGGCCTTGCTGGG - Intronic
1077372494 11:2190006-2190028 GCGTGCACAGAGGCCTGGGCTGG + Intergenic
1078717223 11:13851698-13851720 CCTACCTCACAGGCTTGGGTGGG - Intergenic
1081931271 11:46873135-46873157 TCATCAACACAGACCTGGGTTGG - Exonic
1083677268 11:64333094-64333116 CCATCCACACAGGCGGGGCTGGG - Intergenic
1084402069 11:68950374-68950396 GAGACCACACAGGCCTGGGATGG - Intergenic
1084580301 11:70019147-70019169 CCTTCCACAGAGGCCTGCTTAGG - Intergenic
1084945388 11:72635534-72635556 GCATCCACACAGCCCTGGCTGGG + Intronic
1087155345 11:94896344-94896366 CCGTACCCAAAGGCCTGGCTTGG + Intergenic
1087707681 11:101513274-101513296 CAGTCCACACAGGTCTGCATTGG + Intronic
1089338715 11:117743443-117743465 CTGTGCACACAGGCATGGGCAGG - Intronic
1091207655 11:133832711-133832733 CCGTGCCCACAGGGCTGGGAGGG + Intergenic
1093376331 12:18432374-18432396 CAGTTCCCAAAGGCCTGGGTGGG - Intronic
1097264747 12:57738517-57738539 CCGTCCACCCCGGCCTGGGTGGG + Intronic
1097466321 12:59928948-59928970 CAGTCACCACTGGCCTGGGTTGG + Intergenic
1101192603 12:102350741-102350763 GTGTTCACACAGGCCTGGCTAGG - Intergenic
1101405622 12:104426179-104426201 GCATTCACCCAGGCCTGGGTGGG - Intergenic
1103055489 12:117816904-117816926 CCATCCAAACAGCACTGGGTTGG - Intronic
1103894483 12:124264045-124264067 CCGCCCCGACAGGCCTTGGTGGG + Intronic
1104793485 12:131499174-131499196 CCTTGCACCCAGGCCTGGGTGGG + Intergenic
1105431421 13:20340722-20340744 CCTTCCACAGATGCCCGGGTGGG - Intergenic
1105779602 13:23695319-23695341 CCCTCCAGAAAGGCCTGGGCGGG + Intergenic
1109227793 13:59717494-59717516 CTGTACACACTGGCCTTGGTTGG - Intronic
1110704259 13:78586972-78586994 CCGTCTACACAGGGCAGGGCTGG - Intergenic
1110837142 13:80096068-80096090 ACGTCCTCACAAGCCTGTGTAGG + Intergenic
1112434594 13:99382882-99382904 CGGTACCCACAGGCCTGGGTGGG + Intronic
1113799056 13:113077203-113077225 GCGGCCACACAGACCTGGGGAGG - Exonic
1113985845 13:114314802-114314824 CCGCCCCCACAGGCCGGGGCGGG + Intronic
1114647530 14:24263879-24263901 CTTTCCACTCAGGCTTGGGTGGG + Intronic
1120979788 14:90279725-90279747 CCTTCCACACTGGGCTGGGAAGG - Intronic
1122810332 14:104284557-104284579 CCGCCCACTCAGGCATGGGGAGG + Intergenic
1127726711 15:61757409-61757431 CCAGCTGCACAGGCCTGGGTTGG + Intergenic
1128674815 15:69600741-69600763 CTGTGAACACAGGCCTGGGCAGG - Intergenic
1131259454 15:90881019-90881041 ACGTCCAGTCAGGCCTGTGTGGG + Exonic
1133060571 16:3171861-3171883 CCATCCACACTGGGCTTGGTAGG - Intergenic
1133293576 16:4738499-4738521 CTGGCAACACAGGCCTGCGTTGG - Intronic
1137712418 16:50575524-50575546 CCGTCCCCACAGCCCGGGGAAGG - Intronic
1138350595 16:56344415-56344437 CCGTCAACAAAAGCCAGGGTGGG + Exonic
1138579644 16:57932342-57932364 TCCTCCCCACAGGCCTGGGAAGG - Intronic
1139966358 16:70747698-70747720 CTGTGCAGACAGACCTGGGTGGG - Intronic
1140632805 16:76873965-76873987 CCCTCCACAGAGGCCAGTGTAGG + Intergenic
1141870437 16:86781709-86781731 CCGTCCGCACAGTCCTCTGTAGG + Intergenic
1142025686 16:87812252-87812274 CCCTCCACACAGGCCCGGCTGGG + Intergenic
1147878840 17:43641190-43641212 CCGTCCACACAGGCTTGACTGGG - Exonic
1151358426 17:73573818-73573840 CCATCCACACAGGCCTTTGCAGG - Intronic
1152588736 17:81200692-81200714 AAGGCCACACAGGCCTGCGTGGG - Intronic
1152739573 17:82013026-82013048 GCCTCTACAGAGGCCTGGGTTGG + Intronic
1156491702 18:37500201-37500223 CCGTCCACCCAGGCAGGGGCAGG - Intronic
1157605781 18:48925032-48925054 GCGTCCACACAGACCTTTGTGGG - Intronic
1158565623 18:58551885-58551907 CATTCCACTCAGGCATGGGTTGG - Intronic
1160857306 19:1223379-1223401 CTGGCCAGACAGGCCTGGGCTGG - Intronic
1162810851 19:13163704-13163726 CCCTTAACACAGACCTGGGTGGG - Intergenic
1163669715 19:18620471-18620493 CTGTCCTCACAGGCGTGGGACGG - Exonic
1164492991 19:28731299-28731321 CGGCCCACACAGGCCGTGGTTGG - Intergenic
1165136485 19:33673097-33673119 CGGACCACACAGCCCTGGGCTGG - Intronic
1165156877 19:33794617-33794639 CCCTCCACAAAGGCCTGGGGCGG + Intergenic
1167674799 19:50877533-50877555 CCCTCCTCCCAGGCCTGGGCAGG - Intronic
1168687159 19:58355934-58355956 CCGGCCACCCAGGCCTGTCTGGG - Exonic
925572401 2:5325876-5325898 CCGTGGACACAGGCCTGGGGTGG + Intergenic
925802065 2:7611143-7611165 CAGGCCACACAGCCATGGGTGGG + Intergenic
926010881 2:9407016-9407038 CCGACCACACATGCCTGCCTGGG + Intronic
926295046 2:11562911-11562933 CTGTGCAAACAGGCCTGAGTAGG - Intronic
926299379 2:11591063-11591085 CCGTGCAGACAGCTCTGGGTAGG + Intronic
927662168 2:25002254-25002276 CCTGCCCCAGAGGCCTGGGTGGG - Intergenic
927910083 2:26891364-26891386 CCATTCACGCAGGCCTGGGCTGG - Intronic
930705651 2:54502390-54502412 CCCTTCACAGAGGGCTGGGTTGG - Intronic
933649047 2:84834097-84834119 CCATCCACACAGACCCGGGGTGG + Intronic
938062756 2:128265809-128265831 CCGTCCTCACAGCCCTGGGAGGG + Exonic
938292524 2:130157633-130157655 GCGCCCACACAGCCCTGGGGAGG + Intronic
938712964 2:133991420-133991442 CCTTCCTTACAGACCTGGGTTGG + Intergenic
947726729 2:232406110-232406132 TCGGCCAGACAGGCCTGGGCTGG - Intergenic
947738985 2:232476360-232476382 CCACCCACACAATCCTGGGTGGG - Intergenic
948072624 2:235140114-235140136 CTGTGTGCACAGGCCTGGGTTGG + Intergenic
948909023 2:240993800-240993822 CCGTGCAGGCAGGCCTGGGCTGG - Intergenic
1169318088 20:4609588-4609610 CCTTCCACACAGGCCCAGGGAGG - Intergenic
1172886682 20:38235987-38236009 GCGTCCACACCGGCCTCTGTTGG - Intronic
1175224287 20:57435916-57435938 CCGTCCCCAGAGACCTGTGTTGG + Intergenic
1175268022 20:57714283-57714305 CCGTCCAGGCAGGCCGGGGGTGG - Intergenic
1175776521 20:61657151-61657173 TTGTCCACGCAGCCCTGGGTGGG - Intronic
1176144978 20:63561536-63561558 CTGTCCAGACAGTCCTGTGTAGG - Intronic
1176983128 21:15405853-15405875 TCGTCAACACTGGCCTGGTTTGG + Intergenic
1178141222 21:29686014-29686036 CCGAACACACAGGCCTTGCTGGG + Intronic
1180149746 21:45941393-45941415 CCCCCTACACAGCCCTGGGTCGG - Intronic
1180245744 21:46546157-46546179 TCCTGCACACAGGCCTGAGTCGG + Intronic
1183197132 22:36361240-36361262 GCATCAACACAGGCTTGGGTTGG - Intronic
1185026512 22:48417309-48417331 CCCTCCACTCAGGACTGGGAAGG + Intergenic
1185304289 22:50104316-50104338 CAGTCCACACAGGGCAGGCTGGG - Intronic
951236287 3:20240271-20240293 CTGTCATCACAGGCCTGGGTGGG + Intergenic
961314590 3:126025936-126025958 CCTTACACACAGGCCTGTGATGG - Intronic
961447447 3:126987559-126987581 GGGGCCACACAGGTCTGGGTGGG + Intergenic
961637579 3:128342852-128342874 CTGTCCACACAGTGCTGAGTGGG + Intronic
961680844 3:128598950-128598972 CCGTGCACACAGGGCTGCCTGGG + Intergenic
966883404 3:184362027-184362049 CGGCCCAGACAGGCCTGGGAAGG + Intronic
968392727 4:205959-205981 CCGTCCTCACAGAGCTGAGTTGG - Intergenic
968595355 4:1479446-1479468 CCGTTCTCTCAGGCCTAGGTGGG - Intergenic
969334038 4:6496343-6496365 CCATCCTCAGAGGCCTGGGCTGG - Intronic
969441867 4:7222021-7222043 CCATCCACCCTGGCCCGGGTGGG - Intronic
969703351 4:8779625-8779647 GCATCCCCAAAGGCCTGGGTGGG - Intergenic
973037139 4:45420438-45420460 CCGGCCACACAGGAGCGGGTGGG - Intergenic
980823565 4:138047102-138047124 CCGTGGGCACAGGCCTGGGGTGG - Intergenic
984952751 4:185019161-185019183 ACCTCCCCAAAGGCCTGGGTAGG + Intronic
985495704 5:203878-203900 CCTTGCACACAGGCCCTGGTAGG - Exonic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985650332 5:1104599-1104621 GGGTCAACACAGGCCTGGGCGGG + Intronic
985657259 5:1138817-1138839 CTGTGCACACAGGGCTGTGTCGG - Intergenic
987821520 5:22971456-22971478 GGCTCCACACAGTCCTGGGTGGG + Intergenic
993991034 5:94659768-94659790 CAGTCATCACAGGTCTGGGTAGG + Intronic
997196894 5:131986249-131986271 CCCTTCACACAGGCCTGAGCAGG - Intronic
1002633659 5:180596677-180596699 CCCTCCACACCGCCCTGAGTGGG + Intergenic
1005249739 6:23930813-23930835 CCTTCCAGCCAGGCCTGGATTGG - Intergenic
1007410124 6:41656686-41656708 TCGTACACACAGGCTTGGGGAGG - Intergenic
1016021329 6:139239153-139239175 CAGTCCACACTGACCTGGGAGGG - Intergenic
1019167667 6:170109371-170109393 ACGTCCACACACCCCTGGGGCGG + Intergenic
1019782884 7:2954693-2954715 CCGCCCACACAAGCCCCGGTGGG + Intronic
1020014867 7:4825044-4825066 CCGTCCACACAGGCCTGGGTAGG - Intronic
1022529497 7:31058027-31058049 CTGTCCACACACCCCTGTGTGGG + Intronic
1022558239 7:31322480-31322502 CTGGTCACACAGACCTGGGTTGG + Intergenic
1023769400 7:43541286-43541308 CCCTGCAGACAGGGCTGGGTTGG - Intronic
1023861756 7:44220956-44220978 CCCTCCACACAGCCCAGGGGAGG + Intronic
1023865401 7:44235901-44235923 CTGCCCATGCAGGCCTGGGTGGG + Intronic
1024085035 7:45885504-45885526 CCCTCCCTACAGGCCTGTGTAGG - Intergenic
1024984058 7:55180739-55180761 CCTTCCCCACAGGCCAGGCTTGG - Intronic
1025875781 7:65478687-65478709 CCCACCACAGAGGCCTGGGAAGG - Intergenic
1032094671 7:128932097-128932119 CCCTCGAGACAGGCATGGGTCGG + Intergenic
1032488689 7:132307626-132307648 CCGGCCACGCGGGCCTGGCTGGG - Intronic
1034884013 7:154783812-154783834 TCTTCCTCACAGTCCTGGGTTGG - Intronic
1037963824 8:23118183-23118205 TCGCCCACCAAGGCCTGGGTGGG + Intergenic
1040318549 8:46277523-46277545 CCATCCACACAGGCCTGCCTGGG + Intergenic
1040332920 8:46401442-46401464 TAGCACACACAGGCCTGGGTGGG - Intergenic
1050184959 9:2963499-2963521 TCTTCCTCAGAGGCCTGGGTGGG - Intergenic
1057214307 9:93219578-93219600 CTGTCCACAGAGGGCTGGGCAGG + Intronic
1057290288 9:93802005-93802027 CCCTCCACACACCCCTGGGCAGG - Intergenic
1057871828 9:98723719-98723741 CAGGGCACACAGGCCTGGGGGGG + Intergenic
1059423667 9:114207612-114207634 CAGGCCACACAGCCCTGGGTGGG + Intronic
1059473237 9:114523175-114523197 CCTTGCACATAAGCCTGGGTAGG + Intergenic
1059909328 9:119024998-119025020 CCATAAACACAGGCCTGTGTGGG - Intergenic
1061832102 9:133302851-133302873 CAGTCCTGAAAGGCCTGGGTAGG + Intergenic
1062132979 9:134910181-134910203 CCTTCCTCCAAGGCCTGGGTGGG - Intronic
1062530036 9:136995744-136995766 CCGTCCTCACTCGCCTGGGTGGG + Exonic
1185457187 X:317100-317122 CCGTCCACACCTGCCCGGGGAGG + Intronic
1185603792 X:1355535-1355557 CCGGACACACAGGGCTGGGCTGG + Intronic
1187831997 X:23391711-23391733 CCGTCCCCACAAGTCTGGCTAGG - Intronic
1200240014 X:154488518-154488540 GCATCCACTCAGGCCTGGCTGGG - Exonic