ID: 1020014905

View in Genome Browser
Species Human (GRCh38)
Location 7:4825184-4825206
Sequence CAGTTCTAGAAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020014897_1020014905 10 Left 1020014897 7:4825151-4825173 CCTGGCAGGAGGAACAGGCGTAG 0: 1
1: 0
2: 1
3: 22
4: 265
Right 1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020014905 Original CRISPR CAGTTCTAGAAGAGGGCAGA GGG Intronic
No off target data available for this crispr