ID: 1020016656

View in Genome Browser
Species Human (GRCh38)
Location 7:4835449-4835471
Sequence GGTCTCTCGTGTGCTCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020016656_1020016667 24 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016667 7:4835496-4835518 GCGACAGGCCAGGTCAGGGCTGG 0: 1
1: 0
2: 3
3: 30
4: 456
1020016656_1020016665 19 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016665 7:4835491-4835513 AGACAGCGACAGGCCAGGTCAGG No data
1020016656_1020016669 29 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016669 7:4835501-4835523 AGGCCAGGTCAGGGCTGGCCGGG No data
1020016656_1020016666 20 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016666 7:4835492-4835514 GACAGCGACAGGCCAGGTCAGGG No data
1020016656_1020016662 9 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016662 7:4835481-4835503 CCCAGCTTTGAGACAGCGACAGG No data
1020016656_1020016664 14 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016664 7:4835486-4835508 CTTTGAGACAGCGACAGGCCAGG 0: 1
1: 0
2: 2
3: 4
4: 120
1020016656_1020016668 28 Left 1020016656 7:4835449-4835471 CCCGGAGGAGCACACGAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1020016668 7:4835500-4835522 CAGGCCAGGTCAGGGCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020016656 Original CRISPR GGTCTCTCGTGTGCTCCTCC GGG (reversed) Intronic
900186157 1:1334230-1334252 GGTCTCCTTTGTGCCCCTCCTGG + Exonic
900316519 1:2059924-2059946 GGCCAGTCGTCTGCTCCTCCTGG + Intronic
900917522 1:5649297-5649319 GGTCTCTAGTGAGGTCCCCCGGG - Intergenic
901124175 1:6917625-6917647 GAACTCTCCTCTGCTCCTCCTGG - Intronic
901986960 1:13083313-13083335 GGTCTCTTCTGTGCACCTTCAGG + Intergenic
901994852 1:13143454-13143476 GGTCTCTTCTGTGCACCTTCAGG - Intergenic
902082473 1:13830471-13830493 GGTCTCTCTTGTCCACCTTCAGG + Intergenic
903675597 1:25062721-25062743 GATCTCGCATGTGCTCTTCCAGG + Intergenic
910463210 1:87469768-87469790 CCTCTGTGGTGTGCTCCTCCAGG - Intergenic
913086561 1:115442719-115442741 GGTTTCACGTGTGCTCCTCAGGG + Intergenic
913259803 1:116987849-116987871 GATCCCTCTTCTGCTCCTCCTGG - Exonic
916640531 1:166724181-166724203 GGTCTCTTGTGTGCACTTACGGG + Intergenic
921770915 1:219039021-219039043 TGTCTCTCTTGTGTTCCTCAAGG - Intergenic
922534150 1:226367608-226367630 GGGCTTTCTTTTGCTCCTCCAGG - Exonic
924144147 1:241056614-241056636 GGTCTCTCCTGGGCTTCTCAGGG + Intronic
1065187728 10:23185282-23185304 GATCTCTGGAGGGCTCCTCCAGG + Intergenic
1066079233 10:31913206-31913228 GGTGCTTCCTGTGCTCCTCCTGG - Intronic
1067558849 10:47290442-47290464 GGTAACTCGTGTGCTCAGCCAGG + Intergenic
1067685913 10:48466057-48466079 AGCCTCTACTGTGCTCCTCCAGG - Intronic
1067973807 10:51001265-51001287 GGCCTCTCATTTCCTCCTCCAGG + Intronic
1069743016 10:70697452-70697474 GATCTCTTCTGTGCTCCTCTTGG + Intronic
1070427518 10:76304048-76304070 AGTCACTGTTGTGCTCCTCCAGG - Intronic
1071468541 10:85962172-85962194 GGTCCCTGGTGGGCTCCTACAGG + Intronic
1073143318 10:101262937-101262959 GGTCTCTGGGGCTCTCCTCCTGG + Intergenic
1074134465 10:110614758-110614780 GGTCTCACCTGTGGCCCTCCTGG - Intergenic
1074471327 10:113729372-113729394 GGTCTTTTCCGTGCTCCTCCAGG - Exonic
1076794815 10:132793355-132793377 GGGCTCCAGTGAGCTCCTCCAGG - Intergenic
1077182105 11:1221354-1221376 GGCCACTCGTGTGCTGCCCCTGG - Intergenic
1079084312 11:17434164-17434186 GGCCTCTATTCTGCTCCTCCTGG + Intronic
1079802677 11:24889895-24889917 AGTCTTTCCTGTGCTCATCCAGG + Intronic
1085518909 11:77126954-77126976 GGGCTCTCCTGTGCTCCCCCGGG + Intergenic
1089396111 11:118137093-118137115 AGTGTCTCGTGAGCTCCTCGGGG - Exonic
1089429143 11:118406884-118406906 GGTCTCTAGTGAGTTCATCCTGG + Intronic
1091220212 11:133926204-133926226 AGTATCTCCTGTGCTCTTCCAGG + Intronic
1091817954 12:3453912-3453934 GGTGCCTCGTGTGCTCCTCATGG + Intronic
1092052959 12:5485959-5485981 GGACTGTCTTTTGCTCCTCCAGG - Intronic
1098357097 12:69622156-69622178 GGTCTGTCCTGAACTCCTCCAGG - Intergenic
1103763787 12:123268368-123268390 GGGTTCTCCAGTGCTCCTCCCGG - Intronic
1104058749 12:125250239-125250261 GGTCCCTGGTGAGCTCCTCGTGG + Intronic
1104725994 12:131076077-131076099 GTTCTCTCCTGGGCTGCTCCTGG - Intronic
1110225449 13:73114815-73114837 GGCCTCTGCTGTGATCCTCCAGG + Intergenic
1119785913 14:77314113-77314135 TGGCTCTCTTGTGCTCCTCCAGG + Intronic
1121581864 14:95037697-95037719 GCTCTCACTTGTCCTCCTCCTGG - Intergenic
1122241779 14:100373344-100373366 GGTCTCTTGGGGTCTCCTCCAGG + Intronic
1128343752 15:66841048-66841070 GCTCTCTGGTGTGGCCCTCCAGG - Intergenic
1131291196 15:91108576-91108598 GCTCTCTTGGTTGCTCCTCCCGG + Intronic
1131850293 15:96535442-96535464 CTTCTCTCGTGTGGTCTTCCAGG - Intergenic
1131863980 15:96687015-96687037 GGTCCCTTGAGTGCTTCTCCTGG - Intergenic
1133196810 16:4176925-4176947 GGTCTCACCTGGGCTCTTCCAGG - Intergenic
1133277673 16:4648392-4648414 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277714 16:4648500-4648522 GGTCACCCGGGGGCTCCTCCCGG + Intronic
1133277727 16:4648535-4648557 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277742 16:4648571-4648593 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277756 16:4648606-4648628 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277782 16:4648677-4648699 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277821 16:4648784-4648806 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277835 16:4648819-4648841 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1134155409 16:11838962-11838984 TGTCTCTGCTGTGCTCCTCATGG - Intronic
1137354565 16:47748273-47748295 GGAGACTCTTGTGCTCCTCCTGG + Intergenic
1141810481 16:86372341-86372363 GGTGTCACGAGTCCTCCTCCAGG - Intergenic
1142011523 16:87717540-87717562 GGTCTCTTTTGTTCTCCTTCTGG + Intronic
1142027186 16:87820706-87820728 GGTCTCTGGTTCCCTCCTCCTGG - Intergenic
1142357101 16:89606338-89606360 GGTCTCTTTTCTGCCCCTCCTGG - Intergenic
1147179180 17:38674083-38674105 GTTCGCTCCTGTGCACCTCCGGG - Exonic
1151207769 17:72520826-72520848 GGTGTCTCGGGTGCTTCTCCTGG - Intergenic
1152097606 17:78281013-78281035 GGTCTGTGGTGTTCTCCTTCAGG + Intergenic
1153090988 18:1342502-1342524 AGTCTCTGGTGTGCTGCTACTGG + Intergenic
1153588287 18:6646278-6646300 GTTCTCTCGTATTCTCATCCTGG - Intergenic
1158609426 18:58925227-58925249 GATCCCTCGTGTGTTGCTCCTGG - Intronic
1159904149 18:74075326-74075348 TGTTTCTCATCTGCTCCTCCCGG + Intronic
1160404243 18:78634288-78634310 GGCCTCTCGTGAGCCTCTCCAGG + Intergenic
1162895370 19:13762316-13762338 GGTCTCTCTCCTCCTCCTCCTGG - Exonic
1165356865 19:35309872-35309894 AGTCGCCCCTGTGCTCCTCCTGG + Exonic
1165635336 19:37335196-37335218 GGTCTCCTGAGTGCTCTTCCTGG - Exonic
1166071523 19:40390705-40390727 GGTCTCACGGCTGCTTCTCCTGG - Intergenic
1166632154 19:44416173-44416195 GCTCTCCCGTGTCCTCCTCTGGG + Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
925636966 2:5949895-5949917 AGTCTCTCGTGTTGTTCTCCAGG + Intergenic
925639800 2:5976413-5976435 GGTCACTATTGTGCTCCTGCTGG - Intergenic
926552890 2:14321316-14321338 GGTCTCTGAGGTGATCCTCCTGG + Intergenic
927082894 2:19648087-19648109 GGGCTCTCGTGGGCTACTCCTGG + Intergenic
929830723 2:45344361-45344383 GCTCTCTCCTTTGCTGCTCCCGG + Intergenic
930455189 2:51599447-51599469 TGTCTCTCCTGTGCTGGTCCTGG - Intergenic
930836814 2:55802900-55802922 GGTCTCTCGTGTTTTCCCCCAGG - Intergenic
930853255 2:55984714-55984736 GGCTTCTCAGGTGCTCCTCCTGG - Intergenic
938541698 2:132288439-132288461 GCTCTCCCGTGTCCTCCTCTGGG - Intergenic
1169268740 20:4183191-4183213 GGGTTCTCGTGAGGTCCTCCTGG - Intronic
1169677240 20:8167893-8167915 GGTCTCAGGTGGGCTCCTTCTGG + Intronic
1171869785 20:30515537-30515559 GCTCTCCCGTGTCCTCCTCTGGG - Intergenic
1173572440 20:44086163-44086185 GGGCTCTCCTGTGCTGCTCCAGG - Intergenic
1174055489 20:47795351-47795373 GGTCTCTGCTGGGCTCCTGCTGG + Intergenic
1174363141 20:50040881-50040903 CGGCTCCCATGTGCTCCTCCTGG + Intergenic
1175463289 20:59171195-59171217 GCCCTCTCGTGGGCCCCTCCTGG + Intergenic
1176144704 20:63560364-63560386 TGTCTCTCCTGCCCTCCTCCAGG + Intronic
1179272933 21:39865681-39865703 GGTCCCTGCTGTGGTCCTCCAGG - Intergenic
1179435766 21:41361117-41361139 GGTGTCTGGAGGGCTCCTCCTGG + Intergenic
1181767126 22:25100070-25100092 GGTCTTTCCTGTGGTCTTCCTGG + Intronic
1184693268 22:46127039-46127061 GGCCTCTCTTTTTCTCCTCCGGG - Intergenic
1185121465 22:48974184-48974206 GCTCACCCGTGTGCTCCTCGGGG - Intergenic
1185167203 22:49269022-49269044 GGTCTCTCCTGTGCACTTGCTGG + Intergenic
1185249697 22:49794232-49794254 GCTCTCTCAGCTGCTCCTCCAGG + Exonic
949349112 3:3106271-3106293 GGTCTCTCCTGTGGTTCTACTGG - Intronic
954055094 3:48016435-48016457 GGTATCTGGTGTGTTCTTCCTGG - Intronic
954424799 3:50437712-50437734 GGGCTCTCCTGGGCTCCTGCTGG - Intronic
954865349 3:53724468-53724490 GGTCCCTTCTGTCCTCCTCCTGG + Intronic
955054518 3:55443902-55443924 GGTCTCGCTTCAGCTCCTCCAGG + Intergenic
961820252 3:129572187-129572209 GGTCTATGTTGTGCTCCTCTTGG + Intronic
964406261 3:156352193-156352215 CGTCTCCTGTGGGCTCCTCCCGG + Intronic
969508571 4:7603787-7603809 GGTCACACCTGTGCTCCTCTGGG + Intronic
973972807 4:56230434-56230456 TGTCTCTTGTGTCCTCCACCGGG - Intronic
986561469 5:9064610-9064632 GGTCTGTGGTGTTCCCCTCCTGG - Intronic
988616565 5:32780810-32780832 GGTCTCACGTGCTCACCTCCTGG - Exonic
992387287 5:76297354-76297376 AGTTTCTTGTGTGCTCCTCCAGG - Intronic
994084195 5:95740657-95740679 GGCCTCTGGTGTGCTATTCCTGG + Intronic
997932239 5:138082226-138082248 GGTCTTTCGTTTGTTCATCCAGG + Intergenic
1002328931 5:178428550-178428572 GGCCTCTTGGATGCTCCTCCTGG + Intronic
1002634819 5:180602039-180602061 GATCTCTCGGCTGCTCCTCTGGG + Exonic
1003334989 6:5162333-5162355 GGCCTCTTGTGTGCTCTGCCTGG - Intronic
1003779243 6:9404731-9404753 TGGCTAGCGTGTGCTCCTCCTGG + Intergenic
1019609165 7:1928266-1928288 GTTCTGTCGTGGGCTCCTCTAGG - Intronic
1020016656 7:4835449-4835471 GGTCTCTCGTGTGCTCCTCCGGG - Intronic
1021953928 7:25804857-25804879 GGTCTCTTGCTTGCTCCTTCTGG - Intergenic
1024896952 7:54271238-54271260 GGTTTCTCCTGTGCTTCTCATGG - Intergenic
1027222784 7:76224468-76224490 GGTCTCTTTTTTGCTCCTGCAGG + Intronic
1033576921 7:142694397-142694419 GGCCCCTTGTATGCTCCTCCTGG + Intergenic
1034507911 7:151509651-151509673 GGTCTGTAGTGTGCTGATCCTGG - Intronic
1035234585 7:157487991-157488013 GCTCTCCCGTGTGCTCTCCCCGG - Intergenic
1035468842 7:159097041-159097063 GGTCTCTGGCAGGCTCCTCCTGG + Intronic
1038402302 8:27293942-27293964 GGTTACTTGTGAGCTCCTCCAGG + Intronic
1038661280 8:29499219-29499241 GGTTTCTCGTGCTCTCCGCCTGG + Intergenic
1047370960 8:124255661-124255683 CTTCTCTCATTTGCTCCTCCAGG + Intergenic
1048204384 8:132403735-132403757 GGCCTCTGGTTTGCTCCTGCTGG + Intronic
1049378161 8:142298860-142298882 GGGTGCTCGTGAGCTCCTCCAGG - Intronic
1052890410 9:33694296-33694318 GATCCCTTATGTGCTCCTCCTGG + Intergenic
1058022899 9:100108817-100108839 GGCCTCTCCAGTCCTCCTCCAGG - Intronic
1060790775 9:126484089-126484111 CGTCTCTCGTGTGTTCCCCTAGG + Intronic
1060795084 9:126507775-126507797 GGTCTCTTATGGGATCCTCCGGG - Intergenic
1060970195 9:127733432-127733454 GGCCTTTCCTGGGCTCCTCCTGG - Exonic
1062194286 9:135264310-135264332 GCTCCCTCGTGTGCCCATCCAGG - Intergenic
1062261122 9:135663806-135663828 GGTCTCTCCTCTGCCCCTCCAGG - Intronic
1201673520 Y:16552389-16552411 GGTTTCTCGAGTGTTCCTCATGG + Intergenic