ID: 1020016892

View in Genome Browser
Species Human (GRCh38)
Location 7:4836438-4836460
Sequence CGCTGCCGCCCAGGGCCCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 320}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020016892_1020016900 -5 Left 1020016892 7:4836438-4836460 CCTCGGGGCCCTGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 40
4: 320
Right 1020016900 7:4836456-4836478 CAGCGGGCAGGGCGTTCACTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
1020016892_1020016903 22 Left 1020016892 7:4836438-4836460 CCTCGGGGCCCTGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 40
4: 320
Right 1020016903 7:4836483-4836505 GGCTGGTCTCACTGACTGTGCGG 0: 1
1: 1
2: 2
3: 20
4: 228
1020016892_1020016899 -6 Left 1020016892 7:4836438-4836460 CCTCGGGGCCCTGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 40
4: 320
Right 1020016899 7:4836455-4836477 GCAGCGGGCAGGGCGTTCACTGG 0: 1
1: 0
2: 1
3: 10
4: 110
1020016892_1020016901 1 Left 1020016892 7:4836438-4836460 CCTCGGGGCCCTGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 40
4: 320
Right 1020016901 7:4836462-4836484 GCAGGGCGTTCACTGGGCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 197
1020016892_1020016902 5 Left 1020016892 7:4836438-4836460 CCTCGGGGCCCTGGGCGGCAGCG 0: 1
1: 0
2: 1
3: 40
4: 320
Right 1020016902 7:4836466-4836488 GGCGTTCACTGGGCTCAGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020016892 Original CRISPR CGCTGCCGCCCAGGGCCCCG AGG (reversed) Exonic
900138258 1:1127929-1127951 CGATGACACCCAGGGCCCTGCGG - Intergenic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
900478994 1:2889313-2889335 CCCAGGCTCCCAGGGCCCCGAGG + Intergenic
900559148 1:3295097-3295119 CTCTGCCTCCCAGGGCACCCAGG + Intronic
900603199 1:3511938-3511960 TGCTGCTCCCCAGGACCCCGAGG - Intronic
900695180 1:4005278-4005300 CCCTGCCAGCCAGGACCCCGGGG + Intergenic
901053950 1:6440153-6440175 CCCTGCCGTCCAGGGCTCCCCGG + Intronic
901057404 1:6455108-6455130 CGCCGCCGCCCACGGCCCGCTGG + Intronic
901381603 1:8878391-8878413 CGCCCCCGCCCCGGGCCTCGGGG + Intronic
901771298 1:11531650-11531672 CCCTGACGCCCACTGCCCCGTGG - Exonic
902476955 1:16693371-16693393 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
902480344 1:16708157-16708179 CCCTGCCGTCCAGGGCTCCCCGG - Intergenic
902998040 1:20242984-20243006 GGCTGACGCCCTGGGGCCCGCGG - Intergenic
904031606 1:27536801-27536823 TGCTCCCTCCAAGGGCCCCGGGG + Intronic
904744634 1:32703118-32703140 CGCTGCCGCTCAGCGCCCTCTGG + Exonic
905037757 1:34929189-34929211 CGCTCCCGGTCAGGGCCGCGGGG - Intronic
905422629 1:37859138-37859160 CGTTGCCGCCGAGGGTGCCGGGG - Intronic
905626220 1:39491932-39491954 CGCCGCCGCCCCTGGGCCCGGGG - Exonic
905732179 1:40304746-40304768 AGCTGCCGCAGAGGCCCCCGGGG + Intronic
906032969 1:42735094-42735116 CGCCTCCGCCAAGGGCCCCCTGG - Exonic
907160591 1:52366126-52366148 CGCTGCGGCCCAGGGCCCGCGGG - Exonic
907767369 1:57424161-57424183 CGCGCCCGCCCGGCGCCCCGCGG + Intronic
907880715 1:58546844-58546866 CCCAGCTGCCCCGGGCCCCGCGG + Intergenic
911664698 1:100539490-100539512 TGCTCCCGCCCTGGGCACCGCGG + Exonic
912430157 1:109624619-109624641 CCCTGTCCCCCAGGGCCCCAGGG - Intronic
912576323 1:110675210-110675232 GGCTGCCGGCCCGGGCCCCTAGG + Intergenic
915895694 1:159809272-159809294 GCCTGACGCCCAGGGCCCTGGGG - Intronic
916204027 1:162298118-162298140 CACTGGCACCCAGGCCCCCGTGG + Intronic
919486987 1:198157522-198157544 CGAGGCCGCCAAGGGCGCCGCGG + Intronic
919691287 1:200530695-200530717 TGCAGGAGCCCAGGGCCCCGAGG - Intergenic
920339658 1:205267930-205267952 CCCTGCTGGCCAGGTCCCCGAGG - Intronic
923126687 1:231039995-231040017 CGCCGCCGCCCGGGCCCCCGCGG + Exonic
923348652 1:233081865-233081887 AGCTGCAGCTCAGAGCCCCGAGG - Intronic
923577848 1:235176712-235176734 CACAGCCGCCCGGGGCCCCAGGG + Intronic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1064143076 10:12806523-12806545 CCCTGCTGGCCAGGGCCCAGAGG - Intronic
1065687751 10:28302910-28302932 CCCTGCAGCCCCGGGCCCGGAGG + Intronic
1067797130 10:49328701-49328723 CTATGCTGCCCAGGGCCCAGGGG + Intergenic
1069619133 10:69825729-69825751 GGGTGCCGCCCAGGGCCCCAAGG - Intronic
1072336595 10:94403231-94403253 CGCGGACGCCCAGGAGCCCGAGG + Exonic
1072654307 10:97319671-97319693 CGCCGCAGCCAGGGGCCCCGGGG - Exonic
1072656579 10:97334333-97334355 CGCCGCAGCCAGGGGCCCCGGGG + Exonic
1072659847 10:97357077-97357099 CCCTGAGGCCCAGGGCCCCTGGG - Exonic
1074814500 10:117134301-117134323 CGCCGCCGCCCCGGGCCCAGCGG - Exonic
1076096797 10:127739061-127739083 CGCTTCCTCCCAGGGCACCAAGG - Exonic
1076395716 10:130136344-130136366 CGCAGCCGCTCAGCTCCCCGTGG + Intergenic
1076725607 10:132411528-132411550 GGCTTCAGCCCAGGGGCCCGTGG + Intronic
1076744697 10:132507037-132507059 CGCGGCCGCCAAGGGGCCCATGG + Intergenic
1076750109 10:132538108-132538130 GGCGGCCGCCCCGGGCACCGCGG + Exonic
1076845908 10:133069478-133069500 CTCTGCACCCCAGGGCCCCCTGG - Intergenic
1077095167 11:796049-796071 CGCCGTTGCCCAGGGCCACGCGG + Exonic
1077102234 11:827437-827459 CCCTGCCGCCTTGCGCCCCGAGG - Intronic
1077124225 11:925373-925395 CCCTCCCGCCCCGGCCCCCGCGG + Intronic
1077368148 11:2169539-2169561 TGCAGCTGCCCAGGCCCCCGAGG - Intronic
1077497392 11:2892726-2892748 CGCTGCTGCCCGGAGCCCCTAGG + Intronic
1077886313 11:6390511-6390533 CGGCGCCGCCCGGGGCCCTGAGG + Exonic
1083457108 11:62786686-62786708 CGCTGCCGCCAGGGGGCGCGGGG + Exonic
1083572653 11:63768629-63768651 CGCTGCGGAGCGGGGCCCCGGGG + Exonic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1083794675 11:65008556-65008578 CGCTGCCGCCCACCACCCCCAGG + Intergenic
1083900830 11:65642497-65642519 CGCTGCCGCCGGGGCCCCCACGG + Exonic
1085388334 11:76169757-76169779 CGCTGCAGCTCAGGGCCCTGGGG + Intergenic
1085666217 11:78417612-78417634 CGCGGCCGCCCAGGGGCGGGCGG - Intronic
1087241855 11:95789615-95789637 CGCGAGAGCCCAGGGCCCCGCGG + Exonic
1090056894 11:123431214-123431236 CAGAGCCGTCCAGGGCCCCGGGG + Intronic
1090385704 11:126356461-126356483 CCCTGCCAGCCAGGTCCCCGAGG - Intronic
1090959440 11:131543040-131543062 CGCTGCCTCCCAGGGAGCTGAGG + Intronic
1091129432 11:133133222-133133244 CCCTGCCACCCAGGGGCCTGAGG - Intronic
1091698744 12:2645644-2645666 CCCTGCCCCCAAGGCCCCCGAGG - Intronic
1092241227 12:6837628-6837650 CACTGCCCCCAAGAGCCCCGGGG + Intronic
1094040254 12:26114407-26114429 CGCCGCCCGCCAGCGCCCCGGGG + Intergenic
1094682724 12:32679807-32679829 CGCTGCCTCCAAGGGCACCTGGG + Intronic
1094853725 12:34393711-34393733 CGCGGACGCCCAGGGTCCCCTGG - Intergenic
1096189912 12:49609739-49609761 GGCTGCCACCCAGTGCCCAGAGG - Intronic
1096459382 12:51814033-51814055 ATCTGCAGCCCAGGCCCCCGGGG + Intergenic
1100309218 12:93378442-93378464 CGCTGCCCTCCGGGGCGCCGGGG + Intronic
1102197178 12:111034037-111034059 CGCCGCGGCCCGGGGCCCCTCGG - Exonic
1103348272 12:120265471-120265493 CCCTGCCGGCCGGGGCTCCGCGG - Intronic
1104797061 12:131527297-131527319 CGCTGCGGCCCGTGGACCCGAGG + Intergenic
1104843060 12:131833823-131833845 CCCTCCCGCCCAGGGCACCCTGG - Intronic
1105474280 13:20717622-20717644 CCCTGCTGCCCAGGGCGCGGGGG - Intronic
1105809202 13:23979726-23979748 CGCTGCGGTCCTGGGCCCAGCGG + Exonic
1106781803 13:33066510-33066532 CGCCGCCGCCTAGTGTCCCGGGG - Intergenic
1112319425 13:98393769-98393791 CTCTGAAGCCCAGGGCTCCGTGG - Intronic
1113082715 13:106535145-106535167 CGCTCCCGCCCCGCGCCCTGAGG - Intergenic
1113517415 13:110914510-110914532 CGCTTCCGCCCCGCGCCCCCCGG + Intronic
1113517434 13:110914561-110914583 CGCTGCCGCACAGGCGCCCTAGG + Intronic
1113533457 13:111045915-111045937 GGATGGCTCCCAGGGCCCCGTGG + Intergenic
1113944342 13:114035420-114035442 AGCCCCCGCCCAGGGCCCCATGG - Intronic
1114224129 14:20723250-20723272 CCCTTCCCCCCCGGGCCCCGAGG + Intergenic
1118747006 14:68781562-68781584 CTCTGCAGCCCAGGGGCCTGGGG - Intergenic
1121671603 14:95714388-95714410 CGCTGCTGGCCGGGGCCTCGAGG - Intergenic
1122162268 14:99793235-99793257 CCCTCCCGGCCCGGGCCCCGCGG + Intronic
1122389498 14:101370513-101370535 CACTGCCGCCTGGGGCCGCGTGG + Intergenic
1122401882 14:101472217-101472239 CGCTGCCCCAGAGGGCCCCAAGG - Intergenic
1122630237 14:103104320-103104342 GGCGGCCGCCGAGGTCCCCGAGG + Exonic
1123024883 14:105419872-105419894 CGCCGCCGCCGAGGCCGCCGAGG - Exonic
1123030799 14:105450197-105450219 AGCTCCCGCCCTGGGCCCCTCGG + Intronic
1125051194 15:35299553-35299575 CCGCGCCGCCCAGCGCCCCGCGG - Intronic
1125508950 15:40282706-40282728 GGCTGCAGCCGAGGGTCCCGAGG + Intronic
1125674757 15:41495955-41495977 CGGGGTCGCCCAGGTCCCCGAGG - Intronic
1129221516 15:74134276-74134298 CGCTGGGGCCCTGGGCCCGGCGG + Exonic
1129250852 15:74308166-74308188 GGCTCCAGCCCTGGGCCCCGTGG - Intronic
1129983616 15:79897017-79897039 CGAGGGCGCCCAGGGCGCCGAGG - Exonic
1131291995 15:91114528-91114550 TGCTGGCGCCCAGGGACCCAAGG + Intronic
1132391224 15:101439511-101439533 GGCAGCTGCCCAGGGCCCAGAGG - Intronic
1132544540 16:527335-527357 AGCGGCCGCCCAGAGCCCCGCGG + Intergenic
1132689153 16:1174846-1174868 GGCTGCAGACCTGGGCCCCGGGG - Intronic
1132803984 16:1767300-1767322 GAGTGCCGGCCAGGGCCCCGGGG + Intronic
1132840301 16:1975585-1975607 AGCTCCTGCCCAGGGCCCGGCGG - Exonic
1132872404 16:2121781-2121803 CCCTGCTCCCCAGGACCCCGAGG + Intronic
1133015609 16:2938131-2938153 CCCTGCCACCCAGGCCCCTGTGG + Intronic
1136630216 16:31485567-31485589 CCTTGGTGCCCAGGGCCCCGGGG + Intronic
1138105634 16:54285972-54285994 CGCTGCCGCCAGCGGCCCCCGGG + Exonic
1138540344 16:57683974-57683996 GGCTGCCACCCAGGGCCACGTGG - Exonic
1139751199 16:69109803-69109825 CGGTGCCGCCCAGCACCTCGTGG - Exonic
1140480044 16:75257380-75257402 CACTGCCACCCAGAGCCCCCAGG - Intronic
1140481708 16:75265848-75265870 CGCTGCCCGCCAGGCCCCGGGGG - Exonic
1140661040 16:77191503-77191525 CACTGCTGCCCCGGCCCCCGGGG + Exonic
1141647113 16:85373514-85373536 AGCTGCCTCCCGGGGCCCCTGGG + Intergenic
1141781330 16:86163636-86163658 CTCTGTCGCCCAGGCCCCCCAGG + Intergenic
1142081487 16:88151371-88151393 CGCAGCCGCCCAGCGCTCCCCGG - Intergenic
1142485419 17:244571-244593 CCCTGCCTCCGAGGGCCCCGGGG - Intronic
1142513087 17:410286-410308 CGCTTCCGCCCGGTGCCCCACGG - Intergenic
1142550076 17:732831-732853 CTTTTCCGCCCTGGGCCCCGCGG - Intronic
1142762860 17:2051649-2051671 CGCTGCGCCCCAGGCCCCCACGG - Intergenic
1143166414 17:4899325-4899347 CGCCGCCGCCCGAGGCCCCCCGG - Exonic
1148151094 17:45396767-45396789 CGCGCCCGCCCTGGGCCCCGTGG - Exonic
1149296271 17:55265019-55265041 CGCTGCTCCCCAGCGCTCCGCGG - Exonic
1150289408 17:63972905-63972927 GGCGGCCGCCCAGCACCCCGGGG - Exonic
1150549035 17:66192099-66192121 CGCCGCCGCCCAGCAGCCCGGGG + Intergenic
1151235828 17:72719298-72719320 CCCTGCCTCCCGAGGCCCCGTGG + Intronic
1151831795 17:76557194-76557216 CGCGGCTGCCCAGGGGCCCGGGG - Intergenic
1151960358 17:77402483-77402505 CCCTGCCTCCAAGGTCCCCGAGG + Exonic
1152740049 17:82014839-82014861 AGCTGCCGCCCAGGACACTGGGG - Intronic
1152758789 17:82097929-82097951 CGGAGGCGCCCGGGGCCCCGCGG - Intronic
1153900616 18:9614505-9614527 CGCGGCCGCCCGGGGAGCCGGGG + Exonic
1154475306 18:14748766-14748788 GGCGGCCGTCCTGGGCCCCGAGG + Intronic
1155054568 18:22172041-22172063 CGCGGCCGCCCATGGCCGCCAGG - Exonic
1156171666 18:34493705-34493727 CGCAGCCGCCCACGGCGCCGGGG + Intronic
1156487258 18:37474372-37474394 CCCTGCCCCACAGGGCCCCCTGG + Intronic
1157464073 18:47930143-47930165 CGCTGCCGCCCAGGCTGACGGGG - Intronic
1159586731 18:70289229-70289251 CGCTGCAGCCCCGCGCCCGGCGG - Intronic
1160322149 18:77905870-77905892 CGCTGCTGCCCAGCGCCGCCTGG + Intergenic
1160453129 18:78979136-78979158 CGCTGGCGCCCGGTGGCCCGTGG + Intergenic
1160465082 18:79069493-79069515 GGCTCCCGGCCTGGGCCCCGCGG - Exonic
1160782974 19:885994-886016 CGATGTCGGCCAGGGCCACGCGG + Exonic
1160824071 19:1071337-1071359 CGCTGCCGGGCGGGCCCCCGAGG + Intronic
1160848912 19:1180410-1180432 CTCTGCCGTCCAGGGGGCCGAGG + Intronic
1160987934 19:1848238-1848260 CGCCGGAGCCCCGGGCCCCGCGG + Exonic
1161087297 19:2341028-2341050 CGCTGCCCGCCGGGGCCCGGGGG - Exonic
1161233323 19:3186349-3186371 CCCTGCCGCCCTGGACCCCCGGG + Intronic
1161293162 19:3506502-3506524 CTCCGCCGCCTAGGGCCCGGGGG - Intronic
1161399195 19:4060008-4060030 CCCTGCCGGCCAGGGTCCCCTGG + Intronic
1161473504 19:4472720-4472742 CCCTGCAGCCCAGGACCCCCAGG - Intronic
1161744722 19:6048905-6048927 CGATGCCACCCAGAGCCCCACGG + Intronic
1161981600 19:7633028-7633050 CACTGCTGGCCAGGGCCCCTGGG - Intronic
1162572419 19:11480886-11480908 CGCAACCTCCCCGGGCCCCGCGG - Exonic
1162751763 19:12833861-12833883 CGCCGCCGCCGCGGTCCCCGCGG + Intronic
1164191863 19:22925307-22925329 CGCTGCGGCCCAGGGCAGTGCGG + Intergenic
1165046405 19:33108309-33108331 CGGGGCCGCACAGGGCCTCGTGG - Intronic
1165129646 19:33623542-33623564 CACCGCCGCCCAAGGCCCCCAGG + Intronic
1165879438 19:39032061-39032083 CGCTGCCGCCAAGTGTGCCGGGG - Exonic
1166044975 19:40224664-40224686 CGTCGCCGCCCAGGACCCCGTGG - Intronic
1166504833 19:43364671-43364693 CACAGCAGCCCAGGGCCACGGGG + Intergenic
1166505707 19:43370243-43370265 CACAGCAGCCCAGGGCCACGGGG - Intergenic
1166777966 19:45323786-45323808 AGCGGCCACCCAGGGCCCCGTGG - Intergenic
1167154503 19:47730024-47730046 AGCTCCCGCCAAGGGACCCGCGG - Intronic
1167166546 19:47803200-47803222 GTCTGCCGCCCAGGTGCCCGGGG + Intronic
1167175294 19:47860564-47860586 GTCTGCCGCCCAGGTGCCCGGGG - Intergenic
1167268244 19:48493866-48493888 CGCGCCCTCCCGGGGCCCCGCGG + Exonic
1167360093 19:49025530-49025552 CGCTGATGCCCAGGGCCGTGTGG - Intronic
1167360990 19:49030250-49030272 CGCTGATGCCCAGGGCCGTGTGG + Intronic
1167365022 19:49050285-49050307 CGCTGATGCCCAGGGCCGTGTGG - Intergenic
1167367269 19:49061433-49061455 CGCTGATGCCCAGGGCCGTGTGG - Exonic
1168133819 19:54337540-54337562 GGCTGCCGGCCAGGGCGCTGGGG + Exonic
1202710971 1_KI270714v1_random:19197-19219 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
1202714383 1_KI270714v1_random:34059-34081 CCCTGCCGTCCAGGGCTCCCCGG - Intergenic
925128421 2:1477619-1477641 CGCAGCCACCCAGGGCGCCCAGG - Intronic
925389595 2:3486305-3486327 CCCTCCACCCCAGGGCCCCGAGG + Intergenic
926062210 2:9811800-9811822 CGCTGCAGGCCAGGACACCGGGG + Intergenic
926095802 2:10080137-10080159 GGCTGCCGCTCCGGGCCCCGCGG + Exonic
927786968 2:25981167-25981189 CGCTGCCAGCCAGGTCCACGAGG + Exonic
928171994 2:29010079-29010101 GGCTGCAGCTCAGGGCCCCAGGG + Intronic
929597691 2:43186681-43186703 GGCAGCCTCCCAGGACCCCGGGG + Intergenic
931711209 2:64989970-64989992 CGATGCCGCCCAGACGCCCGAGG - Exonic
932452879 2:71827017-71827039 GGCTGCCGCCCAGGCCTCCTAGG + Intergenic
932595088 2:73088554-73088576 CGGTGCCGCACAGGGCCCTGGGG + Exonic
933706005 2:85290917-85290939 GGCTGCCGCCCAGGGCCTCAGGG - Intronic
936038186 2:109129132-109129154 AGCGGCCGGCCAGGTCCCCGGGG - Intergenic
936537484 2:113323381-113323403 CGCTGCAGCCCATGGCCTCCAGG - Intergenic
938260559 2:129892469-129892491 CGCTGCACCCCAGGGCCTGGAGG + Intergenic
938528522 2:132161340-132161362 GGCGGCCGTCCTGGGCCCCGAGG - Intronic
941978577 2:171431741-171431763 CACTCCCGCCCATGGCCCTGGGG - Intronic
944221655 2:197310207-197310229 CGCCGCCGGCCCGGGCCCCGGGG - Intronic
945404045 2:209423925-209423947 CGCGGCCGCCCACGGGCTCGCGG + Intergenic
946191643 2:218010678-218010700 CGCCGCCGCCCCGGCTCCCGCGG - Intergenic
946308743 2:218871379-218871401 CCCTGCCTCCCAGGCCCCTGGGG + Intronic
947712495 2:232324020-232324042 CCCTGCCTCCCAGGGCTCTGCGG + Intronic
947719887 2:232363835-232363857 CCCTGCCTCCCGGGGCCCTGCGG + Intergenic
947731455 2:232433700-232433722 CCCTGCCTCCCGGGGCCCTGCGG + Intergenic
948116030 2:235494627-235494649 CGCCGCCGCCCCGCGCCCCGGGG - Exonic
948511174 2:238466280-238466302 CTCTCCCGCCCGGGGCCCCTCGG - Intergenic
948824565 2:240568168-240568190 CACTGCCGGCCAGGCCCCTGGGG - Intronic
948939070 2:241187311-241187333 CCCTGAGGCCCAGGGCCCCAAGG + Intergenic
1169120475 20:3092948-3092970 CGGCGGCCCCCAGGGCCCCGCGG + Intergenic
1170150267 20:13220988-13221010 CGCTGCCGCCGAGGGCGCCCCGG + Intergenic
1172010420 20:31843071-31843093 CGCTTCCTCCCAGGCCCCAGGGG + Intergenic
1172227804 20:33316902-33316924 CGCTGCTGCCCCAGGCCCAGGGG + Intergenic
1172234174 20:33358690-33358712 CTCTGCCTCCTAGGGCCCAGGGG + Intergenic
1175678729 20:60968942-60968964 CCATGCCGCCCAGGCTCCCGGGG + Intergenic
1175816376 20:61885093-61885115 CGCTGCCTTGCAGGGGCCCGAGG - Intronic
1175847025 20:62064841-62064863 CCCGGCCGCCGGGGGCCCCGCGG - Exonic
1176042369 20:63072325-63072347 CGCTGCTGCCCCCGGACCCGCGG - Intergenic
1176073531 20:63238493-63238515 CACTGCCACCCGGAGCCCCGAGG - Intronic
1176132247 20:63501014-63501036 CGGTGGCTCCCAGGACCCCGAGG - Intergenic
1176167565 20:63682047-63682069 CCCTGCAGCCCAGGGCCTGGAGG + Intronic
1178367309 21:31998607-31998629 TGCCACCGCCCAGGACCCCGAGG + Exonic
1178855238 21:36245280-36245302 CGCTGCTGTCCGGGGCGCCGTGG - Exonic
1178950325 21:36980609-36980631 CGCGGCCGCCCGGGGCTCTGGGG - Intronic
1179713741 21:43277168-43277190 CCCACCCTCCCAGGGCCCCGCGG + Intergenic
1180172350 21:46066121-46066143 AGCAGCCGCCCTGGGTCCCGGGG - Intergenic
1180622560 22:17171740-17171762 CGCAGCCACCCGGGGCCCGGGGG + Intergenic
1180681025 22:17627192-17627214 CTCTGCCGCCCAGGGTCGCTCGG + Intronic
1181256855 22:21568179-21568201 CGCTGCGGCCCAGGGCGGGGCGG - Intronic
1182273188 22:29168741-29168763 GGCTGCTGCCCAGGGCCTTGTGG - Intergenic
1182357418 22:29728564-29728586 GCCTGCAGCCCAGGGCCCAGAGG - Intronic
1183309515 22:37101806-37101828 CCCTCCAGCCCAGTGCCCCGTGG + Intronic
1183942798 22:41305610-41305632 CTCTGTATCCCAGGGCCCCGAGG + Intronic
1184155252 22:42662726-42662748 GGGCGCCGCCCAGCGCCCCGTGG - Intergenic
1184757095 22:46522961-46522983 CGCTGTCGGCCAAGGCCCCAGGG - Intronic
1185316467 22:50181372-50181394 CCGTGCCACCCAGGGCCACGCGG + Intergenic
1185420197 22:50730769-50730791 CCCCGCCGCCCGGGCCCCCGGGG - Intergenic
1185420659 22:50732516-50732538 CGCTGCCTCCAAGGGGCCCTTGG - Intergenic
949260514 3:2098902-2098924 CGCCGCCGCCCCGGGCCCCTCGG + Intronic
953399537 3:42600818-42600840 CCCTCCCGCCCCGGGCCTCGCGG - Intronic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955368736 3:58332951-58332973 CGCCGCCGCCTAGGGACGCGAGG - Exonic
956979053 3:74614877-74614899 CGCCGCCGCCCAGGGCCCTGCGG - Intergenic
958900136 3:99876274-99876296 CGCCGCGGCCGAGGGTCCCGCGG - Intronic
960687261 3:120306936-120306958 CGCTCACGGCCAGGCCCCCGAGG - Intergenic
962793837 3:138834434-138834456 CTCTGCCGCCCAGGGGCCGGGGG + Intronic
964915711 3:161838768-161838790 CTCTGCCCCCCAGGGCCACTGGG - Intergenic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
966918567 3:184597995-184598017 GGCAGCCGCCCAGGGCCCGCAGG + Intronic
967107919 3:186268965-186268987 TCCTCCAGCCCAGGGCCCCGGGG - Intronic
967858338 3:194134533-194134555 GGCGGGCGCCCAGGGCCCCGCGG + Intergenic
968173467 3:196528880-196528902 CGCCACCGCCCAGCTCCCCGCGG - Intergenic
968524507 4:1049176-1049198 AGCTCCTGCCCAGGGTCCCGGGG + Intergenic
968659635 4:1793702-1793724 CGCCGCCGCCCAGGGCTCCCGGG - Intronic
968929906 4:3573346-3573368 CTCAGCCTCCCAGGGCCCAGGGG + Intergenic
969306888 4:6330907-6330929 GGCTGCAGCCCAGGGGCCCAAGG - Intronic
969379198 4:6783044-6783066 AGCCGCCGCCGAGGGCTCCGGGG + Intronic
969540795 4:7787768-7787790 AGGTGCTGCCCAGGGCCTCGGGG + Intronic
969620743 4:8277551-8277573 CGCTGCTGGCCTGGGCCCTGAGG + Intronic
973620567 4:52722062-52722084 GGGAGCCGCCCCGGGCCCCGCGG + Intergenic
977848174 4:101790929-101790951 CCCTGCGGCCCAGCGCCCCCAGG + Exonic
978741928 4:112146016-112146038 GGCTGGCGCCCAGGGCTCGGAGG + Intronic
980550340 4:134327452-134327474 CGGAGCCGCCCAGGTCCCCCCGG - Intergenic
985484354 5:140355-140377 AGCTGCAGGCCAGGTCCCCGAGG - Exonic
985490324 5:175179-175201 CTCAGCCTCCCAGGGCCACGGGG - Intronic
985515850 5:344179-344201 CTCCACCGCTCAGGGCCCCGAGG - Intronic
985627973 5:999941-999963 CCCTGCAGCCCAGGGCTCCTCGG - Intergenic
985968235 5:3353799-3353821 CTCTGCAGCTCAGGGCCCCTGGG - Intergenic
986299310 5:6465964-6465986 CTCTGCTGCCCAGGGGCCCCAGG + Intronic
986693617 5:10333473-10333495 AGGCGCCGCCCAGGGCCGCGGGG + Intergenic
990365085 5:55062282-55062304 TCCTGCCGCCCAGGGCACCCTGG + Intergenic
992042370 5:72848543-72848565 CGCTGCGGCCCAGCCCCCGGCGG + Intronic
992515875 5:77492063-77492085 CGCCTCCGCCCGGGTCCCCGCGG + Intronic
996542999 5:124649039-124649061 TGCTGCTGCCCCGGGCTCCGAGG - Exonic
997479872 5:134176989-134177011 CGCAGGCGCCGAGGACCCCGGGG + Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
999117722 5:149178352-149178374 CACAGCAGCCCAGGGCCCAGGGG - Intronic
1002447428 5:179297989-179298011 CCCTCCTCCCCAGGGCCCCGGGG + Intronic
1002449060 5:179308810-179308832 AGCTGCATCCCAGGGCCCCTGGG - Intronic
1002455529 5:179344090-179344112 CACTGACGCCCAGGGCCGCTTGG - Exonic
1002565358 5:180110112-180110134 ACCTGCTCCCCAGGGCCCCGGGG - Intronic
1002861089 6:1080267-1080289 CGTTGCTGCCCAGGACCCCTGGG + Intergenic
1003139004 6:3456277-3456299 AGCCCCCGCCCAGGCCCCCGAGG + Exonic
1004044564 6:12012072-12012094 CCTTCCCGCCCCGGGCCCCGCGG + Intronic
1006136244 6:31897707-31897729 CGCGGCCGCCCCGGGTCACGTGG + Intergenic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1006839810 6:37021562-37021584 GGCTGCGGCCCAGGGGCCTGAGG + Exonic
1007074146 6:39056218-39056240 CACTGCCACCCAGGGGCCCCAGG - Intronic
1007584266 6:42979064-42979086 TGCTGCCACCCGGGGGCCCGTGG - Exonic
1009437537 6:63635706-63635728 CGCTGCAGCCCGGGGCCCCACGG + Intergenic
1010032849 6:71288667-71288689 TGCCGCCGCCCAGAGCCCCCAGG - Intergenic
1010414821 6:75601632-75601654 CCCCACCGCCCAGGGCCCCATGG - Intronic
1012450581 6:99349585-99349607 TGCTGCCGCCCAGGGCTCTGGGG - Exonic
1013117860 6:107115777-107115799 GGCCGCAGCCCAGGCCCCCGGGG + Intergenic
1014517733 6:122400003-122400025 CGCTGCCGGCCGGGCCCCCGCGG - Intronic
1016823574 6:148367832-148367854 CGCTGCCACCCAGGCACTCGAGG - Intronic
1017324571 6:153130924-153130946 CGCTCCCGCTCAGGGCGCCGCGG + Intronic
1017631126 6:156397267-156397289 CGTTCCCGCCCAGCGCCCCCTGG + Intergenic
1018017819 6:159727621-159727643 CCCTGCCGCCCGGGCCCCCCGGG - Intronic
1019111964 6:169724081-169724103 CCCTGCCGCCGCGCGCCCCGCGG + Intronic
1019118343 6:169783689-169783711 TGCTGCCACCCACGGCCCCCAGG - Intergenic
1019817805 7:3213937-3213959 CGCTGCCTCCCAGGAGCCTGGGG + Intergenic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1020094809 7:5362339-5362361 TGCTGCAGCCCCAGGCCCCGTGG + Intronic
1021538279 7:21728984-21729006 TGCTACCGCCCAGTGCCCCAGGG - Intronic
1022363441 7:29685317-29685339 GGCCGCCGCCCGGCGCCCCGAGG + Intergenic
1024086349 7:45894637-45894659 AGCTGCAGCCCAGGGCCAGGAGG + Intergenic
1025142837 7:56479773-56479795 TGCTGCTGACCAGGGACCCGTGG - Intergenic
1025709250 7:63891887-63891909 TGCTGCCGACCAGGGAGCCGTGG - Intergenic
1029126259 7:98297008-98297030 CACCGGCACCCAGGGCCCCGCGG + Intronic
1029424340 7:100486860-100486882 CGCGGCCGGCCAGGGGCCTGGGG + Exonic
1033099843 7:138460607-138460629 CGGCGCCGCCGAGGGCCCCCCGG - Exonic
1033654294 7:143362591-143362613 CGATGCAGCCCATGGCTCCGGGG + Exonic
1034815905 7:154171684-154171706 TGCTGCAGCCCAGGGCCACGTGG + Intronic
1035169647 7:157010363-157010385 GGCTGGCGCTCAGGGCCCGGTGG + Exonic
1035618331 8:1019008-1019030 CGCTGCCTCCTATGGCCCCACGG - Intergenic
1039887242 8:41661878-41661900 CGATGCCGCCCAGGAGCACGAGG - Exonic
1041107872 8:54459239-54459261 GGCGGCCGCGCTGGGCCCCGAGG + Exonic
1042040214 8:64581378-64581400 CGCCGCCGCCCAGGCCCCCCGGG - Exonic
1042059093 8:64798419-64798441 CGCATGCGCCCTGGGCCCCGCGG - Intronic
1042508676 8:69589070-69589092 CGCTGCGCCCCACGGCCCCGAGG + Exonic
1047866941 8:129035185-129035207 TGCTGCCTCGCAGGGCCCTGGGG - Intergenic
1049060243 8:140270888-140270910 TGCTGTCGCCCTGGCCCCCGCGG - Intronic
1049151206 8:141036623-141036645 CGCTGCCGCCAAAGGCTCTGGGG + Intergenic
1049442266 8:142614816-142614838 TGCTGCCTCCCAGGGTCCCAAGG + Intergenic
1049577679 8:143397219-143397241 CCCTGCCGCCCAGCACCCTGTGG - Intergenic
1049651472 8:143771743-143771765 CGCCACCGCCCCGAGCCCCGAGG - Intergenic
1049800732 8:144516404-144516426 TGCTGGCTCCCAGGGCCCAGAGG - Exonic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1051170336 9:14314385-14314407 CGCCGCTGCCCAGAGCCCAGGGG + Intronic
1051170604 9:14315457-14315479 CGCCGGCGCCCCGGGCCCCGGGG - Intronic
1053339494 9:37311450-37311472 CTCTGCCGCCCAGGGTGCAGAGG + Intronic
1054460373 9:65459125-65459147 CGCAGCCTCCCAGGGCCCAGGGG - Intergenic
1057033413 9:91796612-91796634 CGCTGACGCCCTGGGCTCAGTGG + Intronic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1057902670 9:98961694-98961716 CACTACCGCCCAGGGCCACCCGG + Intronic
1057904774 9:98975097-98975119 CGCTGCCGCGCACGGTCCCGGGG + Intronic
1057938423 9:99259556-99259578 CGCGGCCGCCCAGGCCCTCGTGG + Intergenic
1059119891 9:111631921-111631943 CTGTGCCCCCCAAGGCCCCGTGG - Intronic
1060412134 9:123406819-123406841 CCCTGCCCCGCGGGGCCCCGGGG + Intronic
1060478168 9:124000271-124000293 CGCAGCCCTCCAGGCCCCCGGGG - Intergenic
1060548814 9:124475736-124475758 GGCTGCCTCCCAGGGGCCTGGGG - Intronic
1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG + Intergenic
1060757937 9:126226311-126226333 CTCTGCTGCCCAGAGCCCCGGGG - Intergenic
1060952400 9:127612495-127612517 CGCTGCCGGCAGGGGCCGCGCGG - Intronic
1061050732 9:128193188-128193210 GGGTGGCGTCCAGGGCCCCGGGG + Intronic
1061144114 9:128787261-128787283 CGCCGCCCCCCAGGGACGCGGGG - Exonic
1061415526 9:130445086-130445108 CTCTGCCTCCGCGGGCCCCGGGG - Intronic
1061415695 9:130445682-130445704 CGCAGCCGCCCAGGGGCCAAAGG - Intronic
1061483114 9:130906898-130906920 TGCTGCTTCCCAAGGCCCCGGGG + Intronic
1061664881 9:132154826-132154848 CTCTGCCTCCCACTGCCCCGGGG - Intergenic
1061666724 9:132164337-132164359 CGCTGCCTCCCCGCGCCCGGCGG + Intronic
1062025188 9:134336993-134337015 AGCTCCCACCCAGGGCCCCCAGG - Intronic
1062570533 9:137183047-137183069 GGCTGCCCCCCAGGACCACGAGG + Intronic
1062611087 9:137373767-137373789 CGCTGCACCCCAGGCCCCCAGGG + Intronic
1203792157 EBV:157524-157546 CGGTGCCCCCCACGGCCCCCGGG - Intergenic
1185608058 X:1378568-1378590 CTCTGCTTCCCAGGGCCCCGGGG + Intronic
1185629919 X:1508295-1508317 CGCTGCTGCCCAGCGTCCCCTGG - Intronic
1189821633 X:44874037-44874059 CGCGCTCGCCCCGGGCCCCGCGG + Intronic
1190333169 X:49248070-49248092 CGCTGGTGCCAAGGACCCCGAGG - Intronic
1190789591 X:53686470-53686492 CGCCTCCGCGCAGGGTCCCGTGG + Intronic
1194788764 X:98119270-98119292 CACTGCCACCCAAGGCCACGAGG - Intergenic
1195954878 X:110318141-110318163 CGCTGCGGCTCAGGCCGCCGGGG + Exonic
1196791398 X:119468335-119468357 CTCTGCCGCCCAGCGCGCCGGGG + Intergenic
1198095508 X:133376289-133376311 CCCTGCCACCCAGGGCCACAGGG + Intronic
1200055286 X:153456922-153456944 GGCTGTTGCCCAAGGCCCCGGGG - Intronic