ID: 1020018435

View in Genome Browser
Species Human (GRCh38)
Location 7:4846007-4846029
Sequence CACCGCGTCCAGCATGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020018432_1020018435 -2 Left 1020018432 7:4845986-4846008 CCAGCGAAGCACAGTCCTGCTCA 0: 1
1: 0
2: 3
3: 12
4: 131
Right 1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1020018429_1020018435 24 Left 1020018429 7:4845960-4845982 CCCTTCGTTAGAGAGGGTCACGG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 97
1020018431_1020018435 23 Left 1020018431 7:4845961-4845983 CCTTCGTTAGAGAGGGTCACGGT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020018435 Original CRISPR CACCGCGTCCAGCATGGCGC TGG Intronic
900690751 1:3978865-3978887 CACTGCCTCCAGCAGGGCCCTGG - Intergenic
904591334 1:31617261-31617283 CACCGCCTCCAGCCTAGCTCCGG - Intergenic
906510017 1:46405541-46405563 CACCGGTCCCAGCATGGCACGGG + Intronic
912414887 1:109501371-109501393 GCCCGTCTCCAGCATGGCGCTGG + Intronic
913557829 1:119986708-119986730 CACAGCATCTAGCATGGTGCTGG + Intronic
916717064 1:167455278-167455300 CCCCGCGTCCGGCTTGGGGCCGG + Intronic
916729491 1:167553502-167553524 CACCGCCTCCAGCGTGGAGATGG + Exonic
922486964 1:225980908-225980930 CACCGCGCCCAGCATAGTGAAGG - Intergenic
924370839 1:243348336-243348358 CACCGCGCCCGGCCTGGGGCGGG + Intronic
1066299996 10:34088121-34088143 CACCGTGCCCAGCCTGGTGCTGG - Intergenic
1066388828 10:34962696-34962718 CACCGCGTCCAGCCTGCCTGTGG + Intergenic
1069352072 10:67539566-67539588 CACCGCAGCCAGCAAGGCACGGG + Exonic
1069900102 10:71702131-71702153 CTCCCGGTCCAGCATGGCGTGGG - Intronic
1070592408 10:77810497-77810519 CACAGCGTCCAGCCTGGCCTGGG - Intronic
1072875534 10:99169215-99169237 CACCGTGCCCAGCCTGGCTCAGG - Intronic
1077024248 11:432264-432286 CACGGCGTCCAGGATGAGGCTGG + Intronic
1077112793 11:869304-869326 CACCGAGTCCAGCACGGCAAGGG - Exonic
1080510336 11:32963637-32963659 CACCGCATCCAGCCTTGCCCAGG + Intronic
1082769985 11:57200460-57200482 CACCGTGCCCAGCATAGGGCTGG + Intergenic
1084270297 11:68025922-68025944 CACAGAGTCCAGCATGGAACAGG + Intronic
1085348357 11:75782501-75782523 CACTTCATCCAGCATGGCTCAGG + Intronic
1085383708 11:76143316-76143338 CAGGGCATCCAGCCTGGCGCTGG + Intergenic
1085678817 11:78551560-78551582 CACCGCGCCCAGCCTGGAGCAGG - Intronic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096809574 12:54160895-54160917 CACCGCCACCAGCGTGGCACCGG + Intergenic
1100407072 12:94280988-94281010 CACCACGTCCAGCCTGGTGTTGG - Intronic
1107025051 13:35793074-35793096 CACAGAGTCCAGCATGGGGGAGG + Intronic
1121044001 14:90774749-90774771 CACCGCGCCCAGCCTAGCGGGGG - Intronic
1121274014 14:92655824-92655846 CACAGCGTCCATCCTGGGGCAGG + Intronic
1122979642 14:105185732-105185754 CCCTGCCTCCAGCATGGCCCAGG - Intergenic
1125689604 15:41585483-41585505 CCCCGCGGCCTGCAGGGCGCCGG - Intergenic
1126734326 15:51716143-51716165 CACCGCGCCCAGCAAGGCAGTGG + Intronic
1130925995 15:88386356-88386378 CACCATGTCCAGCTTGGCTCCGG + Intergenic
1138472818 16:57251669-57251691 CACTGTGTCCAGCCTGGCCCTGG - Intronic
1139954464 16:70686480-70686502 CACCGCACACAGCAGGGCGCGGG + Intergenic
1142018642 16:87766133-87766155 CACCGCGCCCAGCCCGGGGCCGG - Intergenic
1142743449 17:1943292-1943314 CACCACGTGCAGGATGGAGCTGG - Intronic
1142746203 17:1959849-1959871 CACCGCGCCCAGCCAGGCTCAGG + Intronic
1143384795 17:6522622-6522644 CAGAGCGTCCAGCATGAGGCAGG + Intronic
1146806940 17:35872209-35872231 CACCACGTCCAGCCTGGGGAAGG + Exonic
1148642304 17:49197254-49197276 CACCGCGCCCAGCCTGGAGATGG + Intergenic
1152632303 17:81415714-81415736 CACCACATCCAGCATGGAGGTGG - Intronic
1159926831 18:74277286-74277308 CACAGAGTCCAGAATGGAGCAGG - Intronic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1161063192 19:2225543-2225565 CATCGTGTCCCGCATGGTGCTGG + Intronic
1162031748 19:7920570-7920592 CCCCGCCTCCAGCCTGGCTCCGG - Intronic
1162305764 19:9872543-9872565 CCAGGCTTCCAGCATGGCGCGGG - Intronic
1162410579 19:10502925-10502947 CACGGCGCCCAGCATGGCGGCGG + Intronic
1167509276 19:49887764-49887786 CTCCATGTCCAGGATGGCGCAGG - Exonic
934549347 2:95245555-95245577 CACCGTGCCCAGCCTGGAGCTGG + Intronic
948159483 2:235812440-235812462 CCCCTCGTCCAGCCTGCCGCAGG + Intronic
948656354 2:239479074-239479096 CACCGCGCCCAGCCAGGCTCTGG - Intergenic
1173513191 20:43646400-43646422 CTCCACGTCTAGCATGGTGCTGG + Intronic
1174115394 20:48223410-48223432 CCCTGCCTCCAGCATGGCTCTGG - Intergenic
1174839217 20:53885888-53885910 CACCGCGTCCAGCAAGGATTTGG + Intergenic
1175696921 20:61109508-61109530 CACAGCGTCCAGGAAGGAGCTGG - Intergenic
1175935760 20:62513321-62513343 CACGGCGGCCACCATGGCTCCGG - Intergenic
1176168735 20:63687722-63687744 CACCGGGGCCAGCGTGCCGCTGG - Exonic
1178236165 21:30844319-30844341 CACCGCGTCCAGCCTAGCGGGGG - Intergenic
1178321074 21:31606110-31606132 CACCGCGTCCTGCCTCGAGCTGG + Intergenic
1178953979 21:37006888-37006910 CAGCGCGTCCACCGGGGCGCGGG - Intronic
1178978953 21:37244910-37244932 GACTGCTTCCAGCATGGGGCGGG - Intronic
1179471740 21:41614853-41614875 CACCGTGTCCAACAGGGAGCAGG + Intergenic
1181978598 22:26750495-26750517 CACCGTGCCCAGCCTGGCTCAGG + Intergenic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
968765986 4:2469426-2469448 CACCGAGCCCGGCTTGGCGCGGG + Intronic
969891529 4:10264395-10264417 CACCAGGTCCAGCATGGAGATGG + Intergenic
971452200 4:26810602-26810624 CACGGAGAACAGCATGGCGCAGG - Intergenic
976254951 4:83090239-83090261 CACCGCGTCCAGCCTAGAGTTGG - Intronic
985061154 4:186080878-186080900 CACCGCGCCCAGCCTGGAGGGGG + Intronic
985855175 5:2418695-2418717 GAAGGCGTCCAGCCTGGCGCTGG - Intergenic
985945646 5:3180709-3180731 CACCGCTTCCAGCGTGAGGCGGG + Intergenic
991953480 5:71969813-71969835 CACCACGCCCAGCCTGGCACAGG - Intergenic
993635134 5:90334022-90334044 CCCAGTGTCCAGCATGGCTCAGG - Intergenic
998418077 5:141959781-141959803 CACCTCCTACAGCATGGCCCTGG + Intronic
1001219991 5:169892348-169892370 CACAGCTTCTAGCATGGAGCAGG + Intronic
1003116484 6:3286973-3286995 TACCACGGCCAGCATCGCGCTGG - Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1009663536 6:66647008-66647030 CACAGGGTCCAACCTGGCGCTGG + Intergenic
1011795439 6:90947496-90947518 CACCTCCTCCAGCCTGGGGCAGG - Intergenic
1015125262 6:129747348-129747370 CACTGTGTCCAGCTTGGAGCTGG - Intergenic
1016752641 6:147648186-147648208 CTCCGTGTTCAGCATGGCGAGGG + Intronic
1017481124 6:154857178-154857200 CACCGCGTCCAGCCTGTGTCTGG - Intronic
1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG + Intronic
1028796381 7:94908048-94908070 CGCCGCGTCCACCGTGGGGCGGG + Intronic
1034186036 7:149178001-149178023 CACCGCGTCCAGCTGTGCTCAGG - Intronic
1034800635 7:154053230-154053252 CACCGCGTCCCGGAGGGAGCGGG + Intronic
1035476036 7:159144836-159144858 CGCCGCCTCCAGCATGGGCCGGG + Exonic
1035522592 8:287167-287189 GACCATGTCCAGCATGGAGCAGG - Intergenic
1047340651 8:123977236-123977258 CACGGTGTCCAGCATAGAGCAGG + Intronic
1049638055 8:143699945-143699967 CACCGCGCCCAGCCTAGGGCTGG - Intronic
1052831720 9:33221320-33221342 CACCGAGGCCAGCAGGGCCCAGG + Intronic
1056612427 9:88133634-88133656 CCCAGCGTCCAGCAGGGCGGAGG - Intergenic
1062578528 9:137219708-137219730 CACCGCACCCAGCCTGGGGCGGG + Intergenic
1190837398 X:54113621-54113643 CACCGCGCCCGGCCTGGTGCAGG - Intronic
1190848297 X:54214722-54214744 CACCGCGCCCAGCCTGGAGATGG - Intronic
1200094103 X:153649293-153649315 TGCCGGCTCCAGCATGGCGCCGG + Exonic