ID: 1020021806

View in Genome Browser
Species Human (GRCh38)
Location 7:4873745-4873767
Sequence CGCCTGTCCTGCGCCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020021806_1020021812 11 Left 1020021806 7:4873745-4873767 CCCAGGGAGGCGCAGGACAGGCG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1020021812 7:4873779-4873801 GGCGCAGAGCTCACCATCACCGG 0: 1
1: 0
2: 0
3: 8
4: 98
1020021806_1020021811 -10 Left 1020021806 7:4873745-4873767 CCCAGGGAGGCGCAGGACAGGCG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1020021811 7:4873758-4873780 AGGACAGGCGGGCTGCTGGAAGG No data
1020021806_1020021813 14 Left 1020021806 7:4873745-4873767 CCCAGGGAGGCGCAGGACAGGCG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1020021813 7:4873782-4873804 GCAGAGCTCACCATCACCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020021806_1020021816 29 Left 1020021806 7:4873745-4873767 CCCAGGGAGGCGCAGGACAGGCG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1020021816 7:4873797-4873819 ACCGGAGGTATGTAATGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1020021806_1020021815 24 Left 1020021806 7:4873745-4873767 CCCAGGGAGGCGCAGGACAGGCG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1020021815 7:4873792-4873814 CCATCACCGGAGGTATGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020021806 Original CRISPR CGCCTGTCCTGCGCCTCCCT GGG (reversed) Intronic
900363122 1:2299506-2299528 CGCCTCTGCGGCGTCTCCCTCGG + Intronic
900409294 1:2505581-2505603 CACCTGTCCTGAGCCTGCCCCGG + Intergenic
900721679 1:4180202-4180224 GGCCAGTCCTGTTCCTCCCTGGG - Intergenic
901667644 1:10835706-10835728 CACCTCCCCTGTGCCTCCCTCGG - Intergenic
904329003 1:29745741-29745763 CGTCTGCCCTGCAGCTCCCTGGG - Intergenic
904525262 1:31128743-31128765 CTCCTGCCCTGCTCCTCTCTAGG - Intergenic
905732697 1:40307482-40307504 CGCCTGTCCTGCACTGCCCTGGG + Exonic
906198788 1:43946570-43946592 CGCCTGTCCTCGGCCTACCGCGG - Intergenic
906282798 1:44565755-44565777 TGCCTTCCCTGCCCCTCCCTGGG + Intronic
906678239 1:47708627-47708649 CCCCTGGCCTTCCCCTCCCTGGG - Intergenic
907277785 1:53326712-53326734 CGCCTGGGCACCGCCTCCCTCGG - Intronic
907635115 1:56126360-56126382 CTCCTGACCTCCGCCTGCCTTGG + Intergenic
908477672 1:64505616-64505638 CGCCGTTCCTCCCCCTCCCTGGG + Intronic
909661046 1:78082515-78082537 CTCATGTCCTGAGCTTCCCTTGG - Intronic
915621774 1:157090559-157090581 CGGCTGTCCTGTGCATTCCTGGG - Intergenic
920502456 1:206493893-206493915 CGCCTCTCCTGCCTCTGCCTTGG + Intronic
1063379550 10:5575798-5575820 TGCCTGTCAAGAGCCTCCCTCGG - Intergenic
1064351439 10:14581090-14581112 TGCCTGTCCTCCTCCTCCCCTGG - Intronic
1076494091 10:130885502-130885524 CCCCTGTTCAGAGCCTCCCTGGG + Intergenic
1076686881 10:132202181-132202203 CCTCTGTCCTGCGCCTCTCCTGG - Intronic
1077476539 11:2792955-2792977 TGCCTGACCTGCGGCTCCCGGGG - Intronic
1078205221 11:9223311-9223333 CTCCTGACCTCCGCCTGCCTTGG - Intronic
1080791432 11:35525635-35525657 CGCCTGCCCCCGGCCTCCCTGGG - Intronic
1081851666 11:46278563-46278585 GCCCTTTCCTGCGCCTCCCTTGG + Intronic
1082266850 11:50128638-50128660 CGCCTGCTCTGTGTCTCCCTTGG - Intergenic
1082289239 11:50349930-50349952 CGCCTGCTCTGTGTCTCCCTTGG + Intergenic
1083332699 11:61906337-61906359 AGCCTGTCCTGCGCCTCTCTGGG - Intronic
1083595148 11:63915536-63915558 AGCCTGTCCTGCGGCTCACCAGG + Exonic
1083613841 11:64016880-64016902 AGCCTGTCCTGGGCCAGCCTGGG - Intronic
1083784138 11:64934178-64934200 CGCCTCGCCTGCCCCTGCCTTGG + Exonic
1083802897 11:65057233-65057255 TGCCTTTCCTGCCCCACCCTGGG + Intronic
1084514213 11:69627386-69627408 CGCCTGGGCTGAGGCTCCCTGGG + Intergenic
1084666062 11:70577012-70577034 CGCCCGTCCTGCACCTGCCACGG + Intronic
1086306287 11:85484242-85484264 CGCCCCTCCTCCTCCTCCCTAGG + Intronic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1088813451 11:113406561-113406583 TCCCTCTCCTGCGCCTCTCTGGG + Intergenic
1089479111 11:118791039-118791061 CGGCTGGCCTGCGCGCCCCTCGG - Intronic
1090041885 11:123299024-123299046 GGCCTGTGCTGAGCCACCCTCGG - Intergenic
1090465780 11:126931830-126931852 CACGTGTCCTGGGGCTCCCTGGG - Intronic
1091121670 11:133062989-133063011 TGCCTGTCCAGTGCCTCCCATGG + Intronic
1091795381 12:3294900-3294922 CCCCTGTCCTCCGCGTCCCATGG - Intergenic
1092159504 12:6308398-6308420 GGCCTGTCTTCAGCCTCCCTGGG - Intergenic
1092918585 12:13210262-13210284 CGCCTGGCCATCTCCTCCCTTGG + Intronic
1095596131 12:43960274-43960296 CCCCTCTCCAGGGCCTCCCTGGG - Intronic
1096631106 12:52927293-52927315 GGCTTGTCCTGCTGCTCCCTTGG - Intronic
1102426991 12:112851608-112851630 CGCATGGCCTGGGGCTCCCTGGG - Intronic
1105025029 12:132842545-132842567 CTCCTGACCTACGCCTCCCAGGG + Intronic
1106028176 13:25974772-25974794 CTCATGTCCTGCGCATCCCTGGG + Intronic
1113553827 13:111215306-111215328 TGGCTGTCCTGCTCCTCCGTTGG + Intronic
1116959124 14:50952134-50952156 TGGCTGCCCTGCGCCTCCCTGGG - Intergenic
1119569935 14:75661294-75661316 CGGCTGCCCTGAGCCTTCCTGGG + Exonic
1122690856 14:103531610-103531632 CACCTGTCCAGCCCCTCCCCTGG - Intronic
1123442853 15:20303471-20303493 TGCCTGTCCTGGCCCTGCCTTGG + Intergenic
1124206258 15:27723598-27723620 CGCCCCTCTTGCTCCTCCCTGGG - Intergenic
1124396062 15:29303003-29303025 AGACTGGCCTGCTCCTCCCTGGG - Intronic
1124633952 15:31353260-31353282 CGCCTGTGCTGGGCCTCCCCTGG + Intronic
1126688388 15:51267608-51267630 CGCGTCTCCTGCGTCTTCCTGGG - Intronic
1127507932 15:59612791-59612813 CCCCTCTCCTGTACCTCCCTGGG + Intronic
1129424868 15:75455617-75455639 GGCCTGTCCCTCGCCTACCTCGG + Intronic
1132738876 16:1401145-1401167 CCCCAGCCCTGCGCCTCTCTGGG - Intronic
1134149357 16:11794007-11794029 CGCCTGCCAAGAGCCTCCCTCGG + Intronic
1135740570 16:24971860-24971882 TGACTTTCCTGCGTCTCCCTGGG - Intronic
1136189934 16:28609518-28609540 CTCCTGGCCTCAGCCTCCCTAGG - Intronic
1136684563 16:31986606-31986628 TGCCTGCCCTGGGCCTCCCAGGG + Intergenic
1136785187 16:32930142-32930164 GGCCTGCCCTGGGCCTCCCAGGG + Intergenic
1136884595 16:33923662-33923684 GGCCTGCCCTGGGCCTCCCAGGG - Intergenic
1137565018 16:49527384-49527406 CGCACGTCCTCCACCTCCCTTGG + Intronic
1137600166 16:49751012-49751034 GGCGTGTCCTGGGCCTTCCTCGG - Intronic
1141690664 16:85594411-85594433 CGCCTGGCCAGGGCCTTCCTTGG + Intergenic
1142314440 16:89334698-89334720 GGCCTGTGCTGCTCATCCCTGGG - Intronic
1203087847 16_KI270728v1_random:1194151-1194173 GGCCTGCCCTGGGCCTCCCAGGG + Intergenic
1143851555 17:9816027-9816049 GGGCTGCCCTGCACCTCCCTGGG + Intronic
1144726749 17:17506127-17506149 AGCCTGTCCTGAGCCTGCCCTGG + Intronic
1145272774 17:21413528-21413550 GGCCTGTCCAGCTCCTCCGTCGG + Intronic
1145310982 17:21700991-21701013 GGCCTGTCCAGCTCCTCCGTCGG + Intronic
1145868388 17:28255271-28255293 CCCCTGTCCTGCTGCTCTCTGGG - Intergenic
1145973411 17:28970254-28970276 TTCCTGTCCTGCCCCTCCCTGGG + Intronic
1145975081 17:28979177-28979199 CTCCTGTCCCCAGCCTCCCTGGG - Intronic
1146183176 17:30709792-30709814 CACCTGTCCAGCGCCGCTCTGGG - Intergenic
1146581220 17:34040173-34040195 GGGCCCTCCTGCGCCTCCCTTGG - Intronic
1146736213 17:35241596-35241618 CAGCTGTCCTGCACCTTCCTGGG - Intergenic
1147145497 17:38482287-38482309 CGCCTGCCCCGGGCCTCCCAGGG + Intronic
1147769059 17:42855422-42855444 GGCCTGACCAGTGCCTCCCTAGG + Exonic
1148988813 17:51647487-51647509 CCCCTCTCTTGCTCCTCCCTTGG + Intronic
1149849917 17:60028238-60028260 CCCCAGCCCTGCCCCTCCCTGGG - Intergenic
1149860251 17:60118286-60118308 CCCCAGCCCTGCCCCTCCCTGGG + Intergenic
1150108540 17:62478964-62478986 GGGCCCTCCTGCGCCTCCCTTGG + Intronic
1150921895 17:69492676-69492698 CGCCTCTCCTTCTCCTCTCTGGG + Intronic
1151456911 17:74231944-74231966 CCCTTGTCGTGCTCCTCCCTGGG - Intronic
1151696688 17:75721559-75721581 CGCCCGTCCTGGACCTACCTCGG - Exonic
1151959444 17:77397893-77397915 CGCCTGCCTTGGGCCTGCCTTGG + Intronic
1152804877 17:82350902-82350924 CGGCTTCTCTGCGCCTCCCTGGG + Intergenic
1153769936 18:8407398-8407420 CACCTGCTCTGCGCCACCCTGGG + Intergenic
1155091479 18:22515414-22515436 CAGCAGTGCTGCGCCTCCCTGGG - Intergenic
1157386266 18:47261667-47261689 CGCTTCTCCTGTGCCGCCCTAGG + Intergenic
1159625781 18:70692294-70692316 CTCCTCTCCAGCGCCTCCCAAGG + Intergenic
1161067281 19:2244877-2244899 AGCCTGGCCTGAGCCTCCCTGGG + Intronic
1162975618 19:14205982-14206004 CACCTGTCCAGCGCCTCTCTGGG + Exonic
1164769683 19:30799151-30799173 CTCCTGCCCTGCACCTCTCTGGG - Intergenic
1165686840 19:37829221-37829243 AGCCTATCCAGCGCCTCCCAGGG + Intergenic
1166445277 19:42853283-42853305 GGACTGTCCTGAGCCTCCCAAGG + Intronic
1166797825 19:45438716-45438738 AGCGTGACCTCCGCCTCCCTGGG + Intronic
1168319055 19:55498127-55498149 CGACTGCCCTGCTGCTCCCTGGG + Exonic
926225129 2:10961730-10961752 CGCCTCCCCTCCGCCTCCCAGGG + Intergenic
930033203 2:47070534-47070556 TCCCTGTCCTGCCCCTCCCCAGG - Intronic
933700998 2:85255512-85255534 CCCCTGCCCTGGGGCTCCCTGGG - Intronic
933902341 2:86859106-86859128 AGCCTGTCCTGGGTCTCCTTCGG - Intronic
935707989 2:105872947-105872969 CGCCTGTCCTCTGCCTGTCTTGG + Intronic
935778204 2:106490162-106490184 AGCCTGTCCTGGGTCTCCTTCGG + Intergenic
937969189 2:127536434-127536456 GACCTGTCCTGCCTCTCCCTAGG - Intronic
937986137 2:127638938-127638960 CGCCTGGCCTGGCCCTCCCCAGG - Exonic
938322550 2:130374744-130374766 CCCCTGTCCTGCCCTTCTCTGGG + Exonic
946174859 2:217916353-217916375 CCCCTGTGCTGGGCCTGCCTGGG + Intronic
946180119 2:217943906-217943928 CCCCTGTCCTGGGAGTCCCTTGG - Exonic
946772142 2:223099801-223099823 CAGCTGTCCCGCCCCTCCCTGGG + Intronic
1168837099 20:884715-884737 GGCTTGTCCTACCCCTCCCTGGG - Intronic
1169144108 20:3241189-3241211 CTCCTGTCCTGTGCCCCACTGGG + Intergenic
1171196138 20:23201054-23201076 CGCCACTCCTCAGCCTCCCTGGG - Intergenic
1171299359 20:24046108-24046130 CGGCTGTCCTCCGCCTGCCGTGG - Intergenic
1172462666 20:35131863-35131885 CACCTGCCCTGCATCTCCCTGGG - Intronic
1174838107 20:53877020-53877042 CTCCTGTCCTGATCCTCCCCTGG + Intergenic
1175226694 20:57448738-57448760 CCCCTCTCCTGAGCCACCCTGGG + Intergenic
1175374453 20:58514831-58514853 CGAGGGTCCTGCGCCCCCCTCGG + Exonic
1175728001 20:61332547-61332569 TGCCTTTCCTGCCCCACCCTGGG + Intronic
1175821985 20:61914974-61914996 GGCCTGGCCTGAGGCTCCCTGGG - Intronic
1176138352 20:63534774-63534796 CACCTGGCCCGCTCCTCCCTGGG - Intronic
1176147672 20:63572683-63572705 CGCCCGGCCTGCCCCTCCCTGGG + Intronic
1176866492 21:14057417-14057439 TGCCTGTCCTGGCCCTGCCTTGG - Intergenic
1178407409 21:32335922-32335944 GCCCTGTCCTGTGACTCCCTGGG + Intronic
1180090901 21:45533470-45533492 CGCTTGCCTTGCCCCTCCCTGGG + Intronic
1180783561 22:18534893-18534915 CTCCTTCCCTGCGCCTGCCTCGG - Intergenic
1181127128 22:20708944-20708966 CTCCTTCCCTGCGCCTGCCTCGG - Intronic
1181240463 22:21474245-21474267 CTCCTTCCCTGCGCCTGCCTCGG - Intergenic
1181758317 22:25040776-25040798 CTCCTCTCCTGAGCCTCCCCAGG - Exonic
1182548677 22:31089860-31089882 TGCCTCTCCTGAGCCTCCATTGG + Exonic
1184105790 22:42366927-42366949 CGCCTGCCCTGGGCCTCCCCTGG + Intergenic
1184235444 22:43180701-43180723 TGCCTGTCCTCCCCCTCCCCGGG + Intronic
1184766595 22:46575760-46575782 CGTCTGTCCTGTGCCTCCGCAGG - Intergenic
1184795788 22:46731664-46731686 CGCATGCCCTGTGCCTCCCCAGG - Intronic
1185059574 22:48599270-48599292 CGCCCATCCTGAGACTCCCTAGG + Intronic
1185212147 22:49576340-49576362 CCTCTGTCCTGCTCCCCCCTGGG - Intronic
1185213604 22:49586084-49586106 AACCTTCCCTGCGCCTCCCTGGG + Intronic
949935012 3:9109845-9109867 TCCCTCTCCTGCTCCTCCCTGGG - Intronic
950149499 3:10675742-10675764 GGCCTGTCTTCCTCCTCCCTGGG + Intronic
952258567 3:31716575-31716597 CACCTGTGCTGCTCCTCCCTGGG - Intronic
953982630 3:47420290-47420312 CTCCTGTCCTGGGCCACTCTGGG + Intronic
954136558 3:48584677-48584699 GGGCAGTCCTGCTCCTCCCTGGG + Intronic
954461112 3:50627589-50627611 CCCCTCTCCTGGGCCTGCCTAGG - Intronic
954574924 3:51670846-51670868 CTGCTGTGCTGCGCCTCCCTAGG + Intronic
954639808 3:52091126-52091148 CGCCTGTCCTGTGGCTGCCCTGG - Intronic
960601476 3:119463285-119463307 CGGCTGTCCTGGACCTGCCTCGG - Intronic
960938548 3:122918697-122918719 CGCCTGCCCTGCCCCTTCCCTGG + Intronic
961449620 3:126996629-126996651 GTCCTGCCCTGCACCTCCCTTGG - Intronic
964201458 3:154122414-154122436 CGCCGGTTCTGCGCCCCCCGCGG + Exonic
969699541 4:8760654-8760676 CGTCTCTCCTGCTCCTTCCTGGG - Intergenic
969716551 4:8870943-8870965 CCCCTGTCCCCAGCCTCCCTGGG + Intronic
970193383 4:13535000-13535022 CAGCTCTCCCGCGCCTCCCTGGG + Intergenic
978065506 4:104394755-104394777 CGCCTGTCATGCGCTTCTCTTGG - Intergenic
982233588 4:153231710-153231732 CGGCTGTCCCACGCTTCCCTTGG + Intronic
983561554 4:169106886-169106908 CGCCAGGCCTGTTCCTCCCTGGG - Exonic
985212634 4:187611746-187611768 CTCCTGACCTCCGCCTGCCTCGG + Intergenic
985348611 4:189034360-189034382 CGCCTGCCCAGCGTCTCACTCGG + Intergenic
985821585 5:2164201-2164223 CGCCTGCCCTGCGCACCTCTGGG + Intergenic
986016756 5:3764118-3764140 CACCTGTCCTGCGACTGCATCGG + Intergenic
991488196 5:67159671-67159693 CACCTGCCCTGGGCCCCCCTCGG + Intronic
994102619 5:95910542-95910564 AGCCTTTCCTGCTCCTCTCTAGG + Intronic
996815599 5:127569687-127569709 CGCCTCCCCTCCGCCTCCGTGGG + Intergenic
997526294 5:134555253-134555275 GGCCTGTCCTGCCCCTCACTGGG + Intronic
1002485125 5:179530130-179530152 CGCCTGGCCTGCGGCTCACCTGG + Intergenic
1002904701 6:1438871-1438893 CCCTTCTCCTGCTCCTCCCTGGG + Intergenic
1007748734 6:44059003-44059025 CCCCTCTCCCCCGCCTCCCTGGG + Intergenic
1013463509 6:110398283-110398305 CGCCTTTCCTTCACCTCACTGGG + Intronic
1013635723 6:112027465-112027487 CGCCTGTCCTGCCTCTCTCCAGG - Intergenic
1015275237 6:131377326-131377348 CGCCTGGCCTGGACCTCCCTGGG + Intergenic
1018123657 6:160661068-160661090 CCCCTGTCCTGAGGCTCCTTAGG + Intronic
1019184490 6:170213206-170213228 CGTCTGTCTTCTGCCTCCCTGGG - Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019623962 7:2006376-2006398 TGCCTGTCCTGGGCCTCCCCAGG + Intronic
1020021806 7:4873745-4873767 CGCCTGTCCTGCGCCTCCCTGGG - Intronic
1021943777 7:25705203-25705225 CTCCTGCCCTGCCCCTCCCAAGG - Intergenic
1023014759 7:35955969-35955991 CATCTTTCCTGGGCCTCCCTTGG - Intergenic
1023631572 7:42170022-42170044 CTCCTGACCTCCGCCTGCCTTGG - Intronic
1023843703 7:44109789-44109811 AGCCTGTGCTTCCCCTCCCTGGG - Intronic
1024066244 7:45739051-45739073 CATCTTTCCTGGGCCTCCCTTGG + Intergenic
1025025212 7:55510924-55510946 AATCTGTCCTGCTCCTCCCTTGG + Intronic
1026915170 7:74115731-74115753 CGCTTGGCCTGCCCCTCCCCAGG - Intronic
1031426744 7:121614832-121614854 CAACTGCCCTGGGCCTCCCTTGG + Intergenic
1033273485 7:139953705-139953727 GGCCTGTCCTGCCCATTCCTGGG - Intronic
1034166546 7:149028875-149028897 CGCCTCTCCTGCCCCGCCCCCGG - Intergenic
1034536273 7:151727761-151727783 CGGCTGCCCTGCGCCTCCCAGGG - Intronic
1034859250 7:154581963-154581985 CCCCTGTCCTGGGCCACCCTTGG + Intronic
1035363429 7:158329113-158329135 CTTCTGTCGTGCGCCTCCCTCGG - Intronic
1035437160 7:158867735-158867757 GGCCTCTCCTGGGCCTCCCCGGG + Intronic
1036289519 8:7475117-7475139 CACCTGCCCTGCTCCTGCCTGGG - Intergenic
1036331955 8:7836414-7836436 CACCTGCCCTGCTCCTGCCTGGG + Intergenic
1036656653 8:10681453-10681475 CTCCTCTCCTGAGCCTCCCCAGG - Intronic
1037809902 8:22081051-22081073 ATCCTGTCCTTCGACTCCCTAGG - Intronic
1037902038 8:22694142-22694164 CGCCGCCCCTGCCCCTCCCTGGG + Intergenic
1038318486 8:26508005-26508027 GGGCTGTCCTGCGGCTCTCTAGG + Exonic
1038496739 8:28008608-28008630 CCTCTGCCCTGGGCCTCCCTTGG + Intergenic
1038543954 8:28411804-28411826 CGTCTGTCCTGCGGCTCGCTGGG + Intronic
1040059716 8:43093683-43093705 GGCCTGTCCGGAGGCTCCCTAGG + Intronic
1040880758 8:52201759-52201781 CGCCCGTCCTCAGACTCCCTGGG + Intronic
1045770222 8:105728610-105728632 TGCCTTTCCTGTGTCTCCCTTGG - Intronic
1048490266 8:134885541-134885563 TGCCCGTCCTGCTCCTACCTGGG - Intergenic
1049379332 8:142304237-142304259 CGCGAGGCCAGCGCCTCCCTGGG - Intronic
1049406038 8:142452256-142452278 CGCCTCTCTGGCGCATCCCTGGG - Intronic
1049570983 8:143370211-143370233 TCCCTGTCCTGGCCCTCCCTGGG + Intronic
1053424849 9:38004041-38004063 TGCCTGCCCTGCTCCTGCCTGGG + Intronic
1056154058 9:83817569-83817591 CGCCTCTCCCGCGGCTCCCCGGG + Exonic
1056356440 9:85805524-85805546 CGCCTCTCCCGCGGCTCCCCAGG - Intergenic
1056398085 9:86199782-86199804 TGCCTCTTCTGGGCCTCCCTAGG - Intergenic
1056655411 9:88504762-88504784 CGCCTGTCCTGTGTCATCCTGGG + Intergenic
1058636967 9:107046710-107046732 AGTCTGTCCTCTGCCTCCCTAGG - Intergenic
1061220410 9:129247292-129247314 CTCCTGTCCTGGGCCCCTCTAGG + Intergenic
1061371985 9:130202389-130202411 CCACTGCCCTGTGCCTCCCTGGG + Intronic
1061971970 9:134049913-134049935 TGCCTGTCCTGCTCCCCACTTGG - Intronic
1062037209 9:134387779-134387801 AGCCTGTCCTGGGCATCTCTGGG + Intronic
1062514710 9:136926838-136926860 CTCCTCTCCTGGGCCTCCCCAGG + Intronic
1186355368 X:8784225-8784247 GCCCTATCCTGGGCCTCCCTGGG + Intergenic
1186356710 X:8799260-8799282 GGCCCGTCCAGCCCCTCCCTGGG + Intronic
1187154630 X:16712055-16712077 AGCCTGTCCCGCGCGTCCCCGGG - Exonic
1187483821 X:19683288-19683310 GGCCTGTGCTGTGACTCCCTGGG - Intronic
1194781519 X:98029647-98029669 CAACAGTCCTGCACCTCCCTGGG - Intergenic
1199967212 X:152830614-152830636 CGCCTCTCCTGCGCCTTTCTCGG - Intronic