ID: 1020027199

View in Genome Browser
Species Human (GRCh38)
Location 7:4907520-4907542
Sequence ATGGTCTTCTTCAAGAGTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020027199_1020027209 27 Left 1020027199 7:4907520-4907542 CCGTCACTCTTGAAGAAGACCAT 0: 1
1: 0
2: 0
3: 19
4: 198
Right 1020027209 7:4907570-4907592 CACCAGCTCCCAGATGCCCTCGG 0: 1
1: 0
2: 4
3: 34
4: 312
1020027199_1020027204 3 Left 1020027199 7:4907520-4907542 CCGTCACTCTTGAAGAAGACCAT 0: 1
1: 0
2: 0
3: 19
4: 198
Right 1020027204 7:4907546-4907568 CAGGCAGTAGAAGACCCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020027199 Original CRISPR ATGGTCTTCTTCAAGAGTGA CGG (reversed) Exonic
902904945 1:19549562-19549584 ATGGTCTCTGTCAAGTGTGAAGG - Intergenic
904295433 1:29517137-29517159 ATGTTCATCTTCAACAGTGAGGG - Intergenic
904331154 1:29758488-29758510 GTGGTCTTCTCCAAGAGGGGTGG - Intergenic
904415529 1:30359075-30359097 GTGGTCTTCTCCAAGAGGGGTGG + Intergenic
905418694 1:37823528-37823550 ATTCTCTTCTTCAGGACTGAGGG + Intronic
907553292 1:55322992-55323014 ATAGTCTTCTTCCAGGATGATGG - Intergenic
907725845 1:57019597-57019619 ATGGTCTTGTGCATGAGCGAAGG + Intronic
909569473 1:77092402-77092424 ATGGTTTTCTTCAAAACTTATGG - Exonic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919029372 1:192220789-192220811 ATGGTGTTATTCAAGGTTGATGG - Intergenic
919111144 1:193219960-193219982 AAAGTCTTCTACAAGAGTCAAGG + Intronic
920901310 1:210112856-210112878 GTAGTCTTTTGCAAGAGTGAGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922580387 1:226693004-226693026 ATGAGCTGCTTCAAGTGTGATGG + Intronic
923670852 1:236040081-236040103 ATGGTCTCATTCAAATGTGATGG + Intronic
924446265 1:244134847-244134869 GTTGTCTTCTTCCAGAGTGATGG + Intergenic
1062869231 10:885115-885137 ATGGCCTGCTTCAAGGGAGAAGG - Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063886818 10:10588277-10588299 ATAGTCTTCCTCAAGGTTGAAGG - Intergenic
1064399443 10:15009168-15009190 ATCTTTTTCTTCAAGAGAGAAGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1067076044 10:43183152-43183174 ATGTTCTGCTTCAAAAGGGATGG - Intronic
1068451715 10:57197969-57197991 ATGGTCTTCTTCAAGGATCCAGG + Intergenic
1069040151 10:63687400-63687422 ATGAGCTACTTCAAGAGAGAAGG + Intergenic
1069652313 10:70058695-70058717 ATGGTCTTATTGAGCAGTGAAGG - Intronic
1070760478 10:79021322-79021344 ATGGGCTTGGTCAAGAGTGGAGG - Intergenic
1073403764 10:103278711-103278733 ATGGTCTGCTTCAGGGCTGAAGG + Intronic
1073509259 10:104033231-104033253 ATGGACTTCTTCCAAAGTAAGGG - Exonic
1073671721 10:105598283-105598305 CAGATCTTCTTCAGGAGTGAAGG + Intergenic
1075052535 10:119193502-119193524 ATGGTCTGCTTCAGGGGAGAAGG - Intergenic
1075395706 10:122125522-122125544 AGGGACTTCTTCCAGCGTGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080319547 11:30990565-30990587 AAGGTGATCTACAAGAGTGAAGG + Intronic
1082207177 11:49451732-49451754 ATTTTCTTATTCAAGTGTGAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084336679 11:68461530-68461552 ATGGGCTTCTTTAAGAGGGAGGG - Intronic
1084845189 11:71893113-71893135 ATCTTTTTCTTCAAGAGAGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085617269 11:78010390-78010412 ATTGTGTTCTTTAAGAGAGAGGG - Intergenic
1085769666 11:79313630-79313652 ATGCTCTTCTCCAAGTGTGTTGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1089338190 11:117740081-117740103 ATGGGCACCTTCAAGAGAGAGGG + Intronic
1089711556 11:120318524-120318546 CTTGTCTTCTTCAAGAGCAAGGG + Exonic
1090254463 11:125273575-125273597 ATGGTATTTTTCTACAGTGAAGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093612951 12:21184395-21184417 AAGGTGTTCTGCAAGATTGATGG - Intronic
1093648399 12:21615762-21615784 TTGGACTTATCCAAGAGTGATGG - Intergenic
1094702527 12:32883945-32883967 ATGGTCTGCTTCAAGGGAGAAGG - Intronic
1095650721 12:44605467-44605489 ATTGTCTTCTTACAGACTGAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1104509891 12:129367556-129367578 AGGGTCTTCTTCAGGTGTGACGG + Intronic
1105655960 13:22438893-22438915 ATAATCTTCTTTAATAGTGATGG - Intergenic
1105733774 13:23246756-23246778 ATGGGCTTCTTTAAGAGAGACGG - Intronic
1105904056 13:24786639-24786661 AAAGTATTCTTCAAAAGTGAAGG - Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106895021 13:34290654-34290676 ATGTTCTTTCTCAAAAGTGATGG - Intergenic
1112688542 13:101861994-101862016 AAAGTCCTCTTCTAGAGTGATGG - Intronic
1113898417 13:113781531-113781553 AAGGTCTTCACCAAAAGTGAAGG - Intronic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1116520268 14:45837913-45837935 ATGGTATTATTCAAGATTTATGG + Intergenic
1116587186 14:46722078-46722100 ATGGACTTCTTCAGGAGGAAGGG + Intergenic
1116666008 14:47776595-47776617 ATGGTCTGCTTCAGGAGACAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1126640861 15:50825368-50825390 ATGCTCTCCTTAAAGACTGAAGG - Intergenic
1128833158 15:70787637-70787659 ATGTTGTTCTTTAAGAGTAAGGG + Intergenic
1129616753 15:77104931-77104953 ATGCTCCTCTTCCAGGGTGAAGG - Exonic
1131070776 15:89464378-89464400 GTGTTCTTCTCCAAGTGTGAGGG - Intergenic
1138782647 16:59807832-59807854 ATGGTCTTCTTGATCAGTCAGGG - Intergenic
1140859702 16:79008245-79008267 GTTGGCTTCTTCAAGACTGAAGG + Intronic
1145870485 17:28269432-28269454 ATAGTCTTCTTCAAGGGTGTAGG + Intergenic
1146566972 17:33921888-33921910 AGGGGCTGCTTCAAGAGAGAGGG - Intronic
1146982373 17:37176312-37176334 GTGGTGTTCTCCAAAAGTGACGG - Intronic
1149311058 17:55394455-55394477 GTTGTGTTCTTCAAGAGTGATGG - Exonic
1149958300 17:61078226-61078248 ATGGGCTTCTTGAAGAATGTGGG + Intronic
1151273851 17:73018179-73018201 TTAGTCATCTTAAAGAGTGATGG - Intronic
1151383857 17:73743363-73743385 ATGTTCTTCTTCAACAAGGAGGG + Intergenic
1152196146 17:78919529-78919551 ATGGTCTTTTTCAAGAGGGGAGG - Intronic
1153353439 18:4108042-4108064 ATGATCTGCTTCAGGAGAGAGGG - Intronic
1153447931 18:5195416-5195438 ATGGTGTTGTACAAGAGTTAGGG - Intronic
1154321905 18:13361091-13361113 ACGGTCTTCCTGATGAGTGATGG - Intronic
1157051866 18:44175639-44175661 TTGGTCATATCCAAGAGTGATGG + Intergenic
1158428613 18:57362766-57362788 CTGCTATTCTTCAAAAGTGAAGG - Exonic
1158751958 18:60272250-60272272 ATTTTCTTTTTCAAGAGTGTAGG - Intergenic
1158806514 18:60980160-60980182 ATGGCTTTCTTCCAGTGTGAGGG + Intergenic
1161827697 19:6579920-6579942 GTGGTCTTTTTTAAGGGTGATGG - Intergenic
1164136976 19:22425083-22425105 ATGGTCTCATTTAAGAGTTAGGG + Intronic
1164161938 19:22632683-22632705 ATGGTCTCATTCAGGAGTTAAGG - Intergenic
1164758328 19:30707625-30707647 ATTGTCTTCTTGAAGTGGGAAGG + Intronic
1166595070 19:44040009-44040031 ATTTTCTTATTCAATAGTGAAGG + Intergenic
1167129089 19:47572819-47572841 AGGGTCTTCTCCAAGGGGGAAGG + Intergenic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929332604 2:40701659-40701681 AGGGACTCCTTCAAGTGTGAGGG + Intergenic
932979445 2:76646907-76646929 ATGTTCTTCTTCAAATATGAAGG + Intergenic
934895184 2:98112385-98112407 AAAGTGTTCTTCAAGAATGAAGG - Intronic
935016322 2:99185891-99185913 AGTGTCTTCTTCAACAATGAAGG - Intronic
935182172 2:100701097-100701119 GTGTTCTTATTCAAGGGTGAAGG - Intergenic
935847710 2:107184822-107184844 ATGGCCTGCTTCAAGGGAGAAGG + Intergenic
936472909 2:112814595-112814617 ATGGTCTTCTTGAACTCTGAGGG + Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
939115171 2:138052551-138052573 ATCGTCTTCTTAAACAGGGATGG - Intergenic
939626455 2:144483511-144483533 TTGATCTTCTTCAAAAGTAAAGG - Intronic
939739533 2:145888253-145888275 ATTGTCTTCATCAAGAGAGTAGG + Intergenic
940553262 2:155188543-155188565 AAGGTATTCTTCAAGTGGGATGG - Intergenic
942511027 2:176701118-176701140 AAAATATTCTTCAAGAGTGACGG - Intergenic
943825170 2:192381631-192381653 ATGGTCTTTTTAAACAGTAAGGG + Intergenic
945801303 2:214434730-214434752 ATGGTCTTCCTCATCAGTGTTGG + Intronic
946777856 2:223162310-223162332 ATGGTTTTCATCAACACTGATGG + Intronic
946882746 2:224192862-224192884 ATTGGCTTCATTAAGAGTGAAGG + Intergenic
947693211 2:232159289-232159311 ATGGTGTCCTGCAAGAGTGGTGG - Intronic
947929589 2:233952617-233952639 TTGGTCTTGTTCAAGTGTAATGG + Intronic
948918056 2:241048300-241048322 ATGGTCTCCTGCAAGAAAGACGG - Exonic
1175473354 20:59250131-59250153 CTAGTCTTCTCCAAGGGTGAGGG - Intronic
1176691183 21:9911799-9911821 TTGGTCAATTTCAAGAGTGATGG - Intergenic
1176889192 21:14293835-14293857 ATGATGGTCTTCAAGAGAGACGG + Intergenic
1177502540 21:21976610-21976632 ATGTTCTTCATCAAGTGTGTAGG - Intergenic
1180166046 21:46029787-46029809 AAGGTTTTACTCAAGAGTGAAGG + Intergenic
1184302175 22:43568062-43568084 ATGAGCTTCTTCAGGAGTGGGGG - Intronic
1184310638 22:43639366-43639388 AAAGTCTCCTTCAAGAATGAAGG - Intronic
949761648 3:7477551-7477573 GGTGACTTCTTCAAGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG + Intronic
953857804 3:46514589-46514611 ATGGCCTACTTCAGGGGTGAAGG - Intergenic
954585532 3:51732632-51732654 AGGTTATTCTTCAAAAGTGAAGG - Intergenic
956140549 3:66142420-66142442 ATAGTCTACTTCAAAGGTGAAGG - Intronic
957107514 3:75909161-75909183 ATAGGCTTCTTCAAGAGTTGAGG + Intronic
959544528 3:107578729-107578751 ATGGGCTTCTTCAAGGGAGGAGG - Intronic
959695309 3:109243477-109243499 CTGGTCTTCTTCAAGATTAATGG + Intergenic
963841565 3:150112960-150112982 ATGGTATTATTCAAGATTTACGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965792250 3:172402187-172402209 CTAGGCTTCTGCAAGAGTGATGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967393113 3:188976648-188976670 ATGGACTTGTCCAAGAGGGAGGG - Intronic
968832414 4:2939860-2939882 ACTGTCTTCTTGAAGAGGGAGGG + Intronic
969019159 4:4127900-4127922 GTGTTTTTCTTCAAGAGAGAAGG - Intergenic
969730023 4:8949294-8949316 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
969789627 4:9483408-9483430 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
970201270 4:13609647-13609669 ATGGCATTCTTAAAGAGTAATGG - Intronic
971373314 4:26035569-26035591 AGGGTTTTCTTCAGGAGTAAAGG - Intergenic
972804780 4:42517929-42517951 ATAGTGTTCCCCAAGAGTGAAGG + Intronic
975305335 4:72843128-72843150 ATAGTCTTCTACAAAAGGGATGG - Intergenic
975671048 4:76781053-76781075 ATGGTCATCTCGAAGAGTGTTGG - Exonic
975876961 4:78852609-78852631 TTTGTCTTCTTCAAGAGACAAGG + Intronic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978819177 4:112945731-112945753 ATAGTCTTTATCATGAGTGATGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979456447 4:120930808-120930830 ATGACCTGCTTCAAGAGAGAAGG + Intergenic
979632598 4:122921058-122921080 ATCGACTTCTTCCAAAGTGAAGG + Intronic
979753378 4:124307265-124307287 ACAGTCTTCTTTTAGAGTGATGG - Intergenic
982084840 4:151823946-151823968 ATGTTTTTCTGCAAGAGAGAAGG - Intergenic
983143891 4:164188577-164188599 ATATTCCCCTTCAAGAGTGAAGG - Intronic
983357893 4:166687816-166687838 ATGTTATTCTTCAAGGCTGATGG - Intergenic
985314081 4:188635944-188635966 ATGGTCTTTATCAAGAGAAAGGG + Intergenic
986008567 5:3689721-3689743 AAAGTACTCTTCAAGAGTGAGGG - Intergenic
987451937 5:18096054-18096076 ATTGTCTTGATCATGAGTGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992172585 5:74118924-74118946 AGGGACTATTTCAAGAGTGATGG - Intergenic
992721012 5:79561206-79561228 ATGGTCTTTCTAAAGAGTGGTGG + Intergenic
996222132 5:120947208-120947230 TTGGTCTTGTTCCACAGTGAGGG + Intergenic
999412449 5:151363773-151363795 ATGGTGTTATTCAAGATTTATGG + Intergenic
1004290819 6:14365309-14365331 ATGATCTGCTTCAAAAGAGAAGG + Intergenic
1004542366 6:16563173-16563195 ATGGTCCTCTACCAAAGTGAGGG + Intronic
1006062797 6:31437798-31437820 ATAGTGTTGTTGAAGAGTGATGG + Intergenic
1006714148 6:36103712-36103734 ACTGTCCTCTTCAAGAGTCAGGG - Intronic
1010836506 6:80594139-80594161 TTGGTCTTTTTTAATAGTGAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013859319 6:114615745-114615767 ATGCTATTTTTAAAGAGTGATGG + Intergenic
1014435404 6:121415500-121415522 AAAGTATTCTTCAAGAATGAAGG + Intergenic
1014956905 6:127630910-127630932 ATGTTATGCTTCAAGAGAGAAGG - Intergenic
1016985162 6:149889650-149889672 ATGGACTTCTCAAAGAGTGGAGG - Intronic
1019837505 7:3403731-3403753 GTGCTCTTCTGAAAGAGTGAGGG + Intronic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1020597555 7:10227743-10227765 ATGATCTCCTTCAAAAATGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1023213019 7:37829043-37829065 GTGGTCTGCTGCAAGACTGAAGG - Intronic
1023374199 7:39539792-39539814 ATGGTCTTTTTAAAATGTGAAGG + Intergenic
1024791066 7:52965294-52965316 ATGGTCTACTTCATGGGAGAAGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030068675 7:105679816-105679838 AGGGTCTTCTTTAGGGGTGATGG + Intronic
1032221006 7:129994207-129994229 ATGGTCTTCTTTAAGAGACAGGG + Intergenic
1032253640 7:130279543-130279565 GTGGACTTCATCAAGAGTCATGG + Exonic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035566327 8:643576-643598 GTGGTTTTCTTCAAAGGTGAGGG - Intronic
1036058966 8:5293453-5293475 ATTTTCTTCTTCAAAAGAGATGG + Intergenic
1038502463 8:28057070-28057092 ATGGTGTTATTCAAGATTTAGGG - Intronic
1038682287 8:29679812-29679834 ATTCCCTTCTTCAACAGTGAAGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040370394 8:46765343-46765365 ATGGTCTGCTTGAGGAGAGAGGG - Intergenic
1040883122 8:52230069-52230091 ATGCTTTTCCTCAGGAGTGATGG - Exonic
1041437501 8:57858708-57858730 ATGTTCTGCTTCCACAGTGAGGG - Intergenic
1042388750 8:68208078-68208100 TTGGTCTTCCTCCATAGTGAAGG - Intronic
1042631309 8:70820102-70820124 ATGACCTGCTTCAGGAGTGAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052730863 9:32283630-32283652 ATGTTCATCTGCAAGTGTGATGG - Intergenic
1054962582 9:70985271-70985293 ATTTTCTTCTTAAAGAGAGATGG + Intronic
1055441637 9:76342481-76342503 ATGGTCTTCTCCCAGTGTGGGGG - Intronic
1055837050 9:80455869-80455891 ATGGAATTGTTCATGAGTGATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056222563 9:84464804-84464826 ATGCTCATCTTCAAGACAGAGGG - Intergenic
1058866309 9:109165346-109165368 ATGTCCTTGTTCAAGATTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187099469 X:16178551-16178573 ACATTCTTATTCAAGAGTGAAGG - Intergenic
1189905148 X:45751285-45751307 AGGGTTTTCTTCCAGAGTGTGGG - Intergenic
1190830541 X:54055255-54055277 ATGCTCAACTTCAATAGTGATGG - Intergenic
1191135863 X:57064250-57064272 AATGTCTTTTTCAAGAGTAAAGG - Intergenic
1193887364 X:86998934-86998956 ATTGTATTCTTCAATAATGAAGG - Intergenic
1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG + Intergenic
1194736277 X:97515757-97515779 ATGGCCTGCTTCAAGAGAGAAGG + Intronic
1195956750 X:110339252-110339274 ATGCTCTTTATCAAGAATGAAGG + Intronic
1197577367 X:128232027-128232049 AAGCTCTTCTTCAAAAGTGAGGG + Intergenic
1200175596 X:154113719-154113741 AAGTTATCCTTCAAGAGTGATGG - Intergenic