ID: 1020028202

View in Genome Browser
Species Human (GRCh38)
Location 7:4914523-4914545
Sequence CCAGCTCCCTCTCTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020028202_1020028214 29 Left 1020028202 7:4914523-4914545 CCCCAACAAAGAGAGGGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 266
Right 1020028214 7:4914575-4914597 ACCAGCACAGGGCCTGGCACAGG 0: 1
1: 4
2: 25
3: 135
4: 648
1020028202_1020028210 18 Left 1020028202 7:4914523-4914545 CCCCAACAAAGAGAGGGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 266
Right 1020028210 7:4914564-4914586 TACCCTCAGATACCAGCACAGGG No data
1020028202_1020028216 30 Left 1020028202 7:4914523-4914545 CCCCAACAAAGAGAGGGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 266
Right 1020028216 7:4914576-4914598 CCAGCACAGGGCCTGGCACAGGG No data
1020028202_1020028209 17 Left 1020028202 7:4914523-4914545 CCCCAACAAAGAGAGGGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 266
Right 1020028209 7:4914563-4914585 ATACCCTCAGATACCAGCACAGG 0: 1
1: 0
2: 1
3: 13
4: 145
1020028202_1020028213 23 Left 1020028202 7:4914523-4914545 CCCCAACAAAGAGAGGGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 266
Right 1020028213 7:4914569-4914591 TCAGATACCAGCACAGGGCCTGG 0: 1
1: 1
2: 6
3: 67
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020028202 Original CRISPR CCAGCTCCCTCTCTTTGTTG GGG (reversed) Intronic
900591474 1:3462153-3462175 GCAGCTCCCGCTCTCTGCTGGGG + Intronic
900636726 1:3669609-3669631 CCAGCCCCCTCACTCTTTTGTGG + Intronic
900781604 1:4622319-4622341 GCAGCTCCCTGTCTGTGTTTAGG + Intergenic
900864852 1:5260897-5260919 CCAGCTTTGTCTTTTTGTTGGGG + Intergenic
903030120 1:20458063-20458085 GCAGCTCTCTCTCTGGGTTGTGG - Intergenic
906022523 1:42642662-42642684 CTAGAACCATCTCTTTGTTGAGG - Intronic
907881015 1:58549303-58549325 CCAGCTCTTTCTCTTTCTCGGGG - Intergenic
910004944 1:82385101-82385123 TCAGCTCTCTCTCTCTTTTGGGG - Intergenic
910339742 1:86172538-86172560 CCAGCCTCATCTCTATGTTGTGG - Intergenic
911047190 1:93638275-93638297 CCAGCTCCCTCCCTGGGGTGGGG + Intronic
911131127 1:94389501-94389523 CCAGACCCCTCCCTTTGTTTCGG + Intergenic
912668105 1:111601183-111601205 CCACCTGCTTCTCTTTGGTGAGG + Intronic
915930841 1:160060032-160060054 TCAGCTCCCTTTCCTTCTTGGGG + Intronic
916717106 1:167455426-167455448 CCAGCCTCCTCTCTGTCTTGCGG - Intronic
918213556 1:182373467-182373489 CCAGGTCACTCTGTTTGTTTAGG - Intergenic
918856671 1:189764450-189764472 TCAACTCCTTCTCTCTGTTGTGG + Intergenic
919055744 1:192567690-192567712 CCAGCTCCCTCCTGTTGTGGAGG - Intergenic
919539621 1:198830800-198830822 CCACCTCTCTCTCTTTCCTGTGG - Intergenic
919671034 1:200338269-200338291 CCAGCTCCGTACCTTTGTTAAGG - Intergenic
919993369 1:202725141-202725163 CCAGCTCCCTGTTTGTGTTCTGG - Exonic
920544412 1:206803513-206803535 CCAGCTTGTACTCTTTGTTGTGG - Intronic
921840564 1:219823667-219823689 CCACCTCCCTCTCTCTTCTGGGG + Intronic
922715433 1:227868325-227868347 CCAGCTCCCCCTCATTGAAGGGG + Intergenic
923001695 1:230011538-230011560 CTAGCTGCCTCTCTTGGTTTTGG - Intergenic
923004012 1:230030732-230030754 CAATTTCCCTCTCTTAGTTGGGG - Intergenic
923039304 1:230308506-230308528 CCAGCTGCCCCTCTTTGTGGAGG - Intergenic
923134476 1:231105880-231105902 CAAGTTCCCTCTCTGTGTTATGG - Intergenic
923545135 1:234918403-234918425 CCAGCTTCCTCTATTTTTTCTGG + Intergenic
924325573 1:242891078-242891100 ACAGTTTCCTCTTTTTGTTGTGG + Intergenic
1063034836 10:2276264-2276286 CCAGGTTTGTCTCTTTGTTGGGG + Intergenic
1065879441 10:30026664-30026686 CAAGAGCCCTCTCTTTGTAGGGG - Exonic
1066223793 10:33361551-33361573 CAAGCTTCCTCTCTATCTTGTGG + Intergenic
1067104091 10:43353726-43353748 CCAGCTCCCTTTGTTTACTGGGG + Intergenic
1069955805 10:72050695-72050717 CCAGCTCTCTCTGTCTGCTGGGG + Intergenic
1070366639 10:75743104-75743126 CCAGCTCCCTCGCTCCCTTGTGG - Intronic
1070718927 10:78743195-78743217 CCACCAGCGTCTCTTTGTTGTGG + Intergenic
1072459715 10:95607807-95607829 CCAGCTCCTTCTCACTGTTCAGG - Intronic
1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG + Intronic
1074569970 10:114615365-114615387 CCAGCTCCCTCTCCTCCTTCTGG + Intronic
1077247018 11:1544605-1544627 CCAGCTCCCTCTCCTGGATTGGG + Intergenic
1078123039 11:8529962-8529984 CCAGCTCTGTCTGTTTTTTGGGG - Intronic
1078520098 11:12056032-12056054 CTGGCTCCCTTTCTTTTTTGGGG - Intergenic
1078971881 11:16423268-16423290 CCTGCTCTCTCACTTTGTTCAGG + Intronic
1079507517 11:21169945-21169967 CAAGAGCCCTCTCTTTGTAGGGG + Intronic
1080594584 11:33759421-33759443 CCAGGTCCCTCTCTCCTTTGTGG - Intronic
1081885938 11:46496451-46496473 CCAGCTCTCTCTCATGGGTGTGG - Intronic
1084042961 11:66553255-66553277 CCAGCTGCATCTATTTTTTGGGG - Intronic
1084485415 11:69445084-69445106 CCAGCAGCCTCTGTTTGGTGGGG + Intergenic
1084556805 11:69880434-69880456 CCTGCTCCTTCCCTTTCTTGAGG + Intergenic
1085864934 11:80279877-80279899 CCAGGTCCACATCTTTGTTGTGG - Intergenic
1086364879 11:86098856-86098878 CAAGTTCCCTCTCTTTGAAGAGG - Intergenic
1087218620 11:95521596-95521618 CCAGATCCATGTGTTTGTTGGGG + Intergenic
1088322609 11:108569034-108569056 CCAGCTCACTCTTTTGCTTGTGG + Intronic
1090566367 11:127996124-127996146 CTAACTCCCTCTCTGTCTTGTGG - Intergenic
1092016497 12:5163273-5163295 CCAGAGCCCTGTCTTTCTTGAGG - Intergenic
1092059509 12:5536973-5536995 CCAGCTCCCTCTCTGACTTTGGG - Intronic
1093886456 12:24467061-24467083 CCAGCTCTTTATCTTTGCTGAGG - Intergenic
1094085184 12:26582943-26582965 CCATCTCCCTCTCCTTGTAGGGG + Intronic
1094108741 12:26839146-26839168 CCAGCTCCCTCTGCTTGCTGTGG + Intergenic
1095475792 12:42586174-42586196 CTAACTCCTTCTCTTTATTGTGG + Intronic
1095875477 12:47075997-47076019 CCAGCTCCTTCTCTTTTCTCAGG - Exonic
1096718053 12:53502715-53502737 CCAGCTCTCTGTATTTATTGAGG + Intronic
1096750514 12:53756039-53756061 CCAGCTCCCTGGCTTGGTGGAGG + Intergenic
1097642250 12:62196553-62196575 CCAACTCCCTCTCTCTCCTGGGG - Intronic
1099178498 12:79451374-79451396 TCAACTCCCTCTCTTTGGTAGGG - Exonic
1099712185 12:86242067-86242089 CCAGTTGCCTCCCTTTGCTGGGG + Intronic
1099982715 12:89625285-89625307 CCAGCTGCCTCTATTTTTGGGGG - Intronic
1102340914 12:112121022-112121044 CCAGCTCCCTCTGTCTTTTGAGG - Intergenic
1103053153 12:117798334-117798356 CCAGCTTCCTCTGTTTCTTTAGG - Intronic
1103341167 12:120221879-120221901 CCAGCTCCCTGTCTCTCCTGGGG + Intronic
1103432035 12:120896249-120896271 ACAGCTCCACCTCATTGTTGTGG - Intronic
1103486904 12:121289078-121289100 CCAGCCCGCTCTTTTGGTTGGGG - Intronic
1103758677 12:123232470-123232492 CCAGCTCCCTTTTTTTGCTAGGG - Intronic
1103795349 12:123499444-123499466 CCAGCTCCCTGTCCTTGGCGCGG + Exonic
1105316172 13:19266123-19266145 ACAGCTCCCTCCCTGTGTTCTGG - Intergenic
1108350207 13:49585157-49585179 CTGCCTCCCTCTCTTTTTTGAGG - Intronic
1108541424 13:51451352-51451374 CCAGCTTCCTCTCTAGGTTTTGG + Intronic
1110868951 13:80428337-80428359 CCATCTCCCACTCTTTGTTCTGG + Intergenic
1112543933 13:100345764-100345786 CCAGCTGACTCTCTTGGTAGGGG + Intronic
1113325362 13:109276393-109276415 CCATGTCCCTCTCTTGGTGGAGG + Intergenic
1113801210 13:113087306-113087328 CCAGCTCCTTCACCTTGGTGTGG - Exonic
1115097070 14:29650019-29650041 CCAGCTCCCTTTCCTGGTTGGGG + Intronic
1118005636 14:61562270-61562292 CCAACTCCCTTTGTGTGTTGCGG - Intronic
1118278832 14:64410520-64410542 CCGGCCTCCTCTCTGTGTTGGGG + Intronic
1118926036 14:70190168-70190190 CCAACTCCATTTTTTTGTTGAGG + Intergenic
1119196488 14:72720555-72720577 CCAGCCCCCTCACTGTGTTCAGG + Intronic
1121109482 14:91303067-91303089 CCAGCTGCTTCCCATTGTTGGGG - Intronic
1121856053 14:97271096-97271118 TCTTCTCCCTCTCTTTGTGGTGG + Intergenic
1123841137 15:24248106-24248128 GCAGCTCCCTGCCTTGGTTGTGG + Intergenic
1123855411 15:24405488-24405510 GCAGCTCCCTGCCTTAGTTGTGG + Intergenic
1123871375 15:24577503-24577525 GCAGCTCCCTGCCTTGGTTGTGG + Intergenic
1124169633 15:27360988-27361010 CCATCTCCCTTTCTCAGTTGGGG - Intronic
1126976807 15:54191875-54191897 CCTTCACCCTCTTTTTGTTGGGG + Intronic
1127291262 15:57573561-57573583 CCAGCTTCCTCACTTAGTTGTGG - Intergenic
1129697904 15:77751062-77751084 CCATCTCCCTCTCTGTGTCCAGG + Intronic
1131676576 15:94676151-94676173 GCATCTCCCTCTCTTTGCTCTGG - Intergenic
1134679556 16:16114719-16114741 TCAGCTCCCTCTCTGCATTGTGG + Intronic
1134915107 16:18062745-18062767 CCAGCTCCCTCACCTTGTAATGG + Intergenic
1137419426 16:48318919-48318941 CCAGCTTCCTGTTTTGGTTGAGG - Intronic
1138193689 16:55036584-55036606 CAAACTCCCTGTCTTTGTGGAGG - Intergenic
1139276623 16:65733605-65733627 GCTGCTCCCTCTCTTTGATAGGG - Intergenic
1139297014 16:65909911-65909933 TCAGCTCCCTTTCTTGGTTTGGG - Intergenic
1140127868 16:72132901-72132923 CCAGCTCCTTCTCCTTTTTCAGG + Exonic
1140219201 16:73031677-73031699 CCAGCTCGTTCTGTTTGCTGTGG - Intronic
1140411110 16:74740911-74740933 CCTGCTGCCTTTCTTTCTTGTGG - Intronic
1140498306 16:75409428-75409450 CCTACTGCCTCTCTTTGTGGCGG - Intronic
1141868237 16:86765823-86765845 CCAGCTCCCTCTCCTTGGGTGGG - Intergenic
1141999104 16:87653931-87653953 CCAGCTGCCCATCTTTGGTGCGG + Intronic
1142540725 17:656979-657001 CCGGGTACCTCTCTCTGTTGGGG + Intronic
1143938859 17:10516801-10516823 CCACCTCCCTGGCTTGGTTGAGG + Intronic
1147038206 17:37697691-37697713 CGAGTTCCCACTCTTTGTAGTGG - Intronic
1147323533 17:39659662-39659684 CCAGCTCCCTCTCTTGGGGCAGG - Intronic
1147419113 17:40313274-40313296 CCTGCTCCCTTCTTTTGTTGGGG - Intronic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1149991827 17:61387747-61387769 CCAGCACCCGTTCTTTCTTGGGG + Intronic
1150743040 17:67795026-67795048 CATCCTCCCTCTCTTTGCTGGGG + Intergenic
1152795043 17:82302548-82302570 CCAACTCCCTCTCCTTGTGGCGG - Intergenic
1153341844 18:3983460-3983482 CCAGCTCACACTAGTTGTTGGGG + Intronic
1155922478 18:31616991-31617013 GCAGCTCCCTTTCTTGGTTATGG + Intergenic
1156412190 18:36841227-36841249 CAAGTTCCCTCTCTCTTTTGTGG + Intronic
1156482276 18:37443714-37443736 CCCTCTCCCTCTCTGTGTCGGGG + Intronic
1157083795 18:44556222-44556244 CCAAGTCCATCTCTTTCTTGAGG - Intergenic
1157131924 18:45015176-45015198 CCTACTCCATCTCATTGTTGAGG - Intronic
1161037529 19:2093737-2093759 CCAGCTCCCTCTCTTTCCACAGG - Intronic
1162171896 19:8796665-8796687 CCTTCTCCCACTTTTTGTTGGGG + Intergenic
1162186877 19:8912467-8912489 CCTTCTCCCACTTTTTGTTGGGG - Intronic
1164917753 19:32065734-32065756 CAAGCTCCCTCTCTGCTTTGGGG - Intergenic
1165007929 19:32821839-32821861 CCAGCTCCTCCTCTTTGCTGAGG - Intronic
1166067083 19:40366276-40366298 CCAGCTTCCTCTTTTTGGGGTGG + Intronic
1166657557 19:44623340-44623362 CCAGCTCCCTCTCTGCTATGTGG - Intronic
1167280979 19:48568412-48568434 CCAGCTCCTTCTCTGTCTTCAGG - Intronic
1167671263 19:50855087-50855109 CCAGCTCCCTGTCTGGGCTGGGG - Intronic
1168056183 19:53866501-53866523 TCAGCTCCCTCTTTTTCTTTTGG + Intronic
1168160247 19:54505667-54505689 CCAGGCACCTCTCTTTGTTCTGG + Intronic
1168605479 19:57756297-57756319 CAAGCTGCCTCTCATTGTTCTGG + Exonic
925172653 2:1759703-1759725 CCGGCTCCCTCTGCTTGTGGGGG - Intergenic
927372315 2:22370736-22370758 CCACCTTCCCCTCTTTGTTCTGG - Intergenic
927708258 2:25310349-25310371 CCAGCCCCCTCCCTCTGCTGCGG + Intronic
928400628 2:30976137-30976159 ACATCTCCCACTCTTTGTTCTGG + Intronic
929051482 2:37840548-37840570 CCAGCTCTCTTTCTTTCTTATGG + Intergenic
931486413 2:62697382-62697404 CCAGCTCTTTCCTTTTGTTGTGG - Intronic
931722328 2:65076223-65076245 GCAGCTTCCTCTCTCTGTAGTGG - Intronic
932264787 2:70358236-70358258 CCCCCTCCCTTTCTTTGTTTGGG - Intergenic
932357160 2:71076403-71076425 CCAGCTACCTCCCTCTGTAGAGG - Intronic
933199453 2:79432573-79432595 CCAACTTCCTCCCTTTGGTGAGG - Intronic
935198365 2:100834460-100834482 CCAGCTGACTCTCTTAGGTGCGG + Intronic
935372121 2:102357540-102357562 CTAGCTCCCACTCTCTGGTGAGG - Intronic
936528329 2:113257563-113257585 CCAGCTCCCTCTCACTATTGGGG - Intronic
938369858 2:130762267-130762289 CCAGCTGCGCCCCTTTGTTGGGG - Exonic
940076665 2:149749586-149749608 CCACCTCCCTAACGTTGTTGAGG + Intergenic
940346719 2:152636536-152636558 TCAGCTTCCCCTCATTGTTGAGG - Exonic
940346740 2:152636679-152636701 CCATTTCCCTCTGTTTGTGGAGG + Intronic
944136735 2:196407573-196407595 GCACCTTCCTCTCTGTGTTGGGG - Intronic
944536770 2:200718003-200718025 CCAGCTCCCTCTCTTGACAGGGG - Intergenic
945517074 2:210775516-210775538 CCAGCTTCTTCTTTTTCTTGGGG - Intergenic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
945991295 2:216397530-216397552 CCTGTTCCCTGTCCTTGTTGAGG - Intergenic
946640696 2:221780615-221780637 CCAGCTCCCTGGCCTTGGTGAGG + Intergenic
946822634 2:223646213-223646235 CCAGCTCCCTGTTTATTTTGAGG - Intergenic
947718449 2:232353196-232353218 CCGGCTCCCTCACTCTTTTGGGG + Intergenic
948610585 2:239163855-239163877 CCAGCGCCTTCTTTTTATTGAGG + Exonic
948891813 2:240910520-240910542 CCAGCTGTCCCTCTTTGCTGAGG + Intergenic
1170883988 20:20322377-20322399 CCATCCCTCTCTCTTTGTGGGGG - Intronic
1171047262 20:21821885-21821907 CCAGCTCCCTCTCCATTGTGGGG + Intergenic
1171372857 20:24672923-24672945 TCAGCTAGCTCTCTTTGTGGGGG - Intergenic
1172067097 20:32229092-32229114 CTGGCTCCCTTTCTTTGTGGGGG - Intronic
1172881020 20:38200066-38200088 CCAACTCACTCTCATTGCTGGGG - Intergenic
1172977972 20:38920540-38920562 CCAGCTCCCTCTCTGGGTTATGG - Exonic
1173416605 20:42862462-42862484 CCAACTTCCTCTCTTGCTTGAGG - Intronic
1176423530 21:6533913-6533935 CCAGCTCCCACTCATAGCTGGGG - Intergenic
1179699024 21:43142229-43142251 CCAGCTCCCACTCATAGCTGGGG - Intergenic
1180706816 22:17815328-17815350 CCACCTCCCTCACGTTGCTGTGG - Intronic
1181493433 22:23274937-23274959 CCACCTCCTTCTCTTTCTTCTGG + Intronic
1182715360 22:32353387-32353409 CCCGCGCCCTCTATGTGTTGCGG - Intergenic
1182776957 22:32838372-32838394 CCAGCTGCCCCTCTTCCTTGTGG - Intronic
1183463780 22:37968745-37968767 CCAGCTCCTCCTCTTTGAAGGGG - Exonic
1183594185 22:38800125-38800147 ACAGCACCCTTTCTTTTTTGGGG + Intergenic
1184231988 22:43163275-43163297 CCAGCTCCCCCTCTTCCCTGTGG - Intergenic
1184456857 22:44615887-44615909 CCAGCTCCCTGTCCCTGTGGAGG + Intergenic
1185125760 22:49009845-49009867 CCAGCTGACTCTCTGTGATGGGG - Intergenic
949598002 3:5567894-5567916 ACAGCTCCCTCTCAAAGTTGTGG - Intergenic
949767402 3:7542408-7542430 CCTGCTCCCTCTCTGTCTTTGGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950740338 3:15045859-15045881 CCAGCTGCCTCTCCTCATTGAGG - Exonic
951609466 3:24476038-24476060 CCAGCTGCTGCTCTTTGGTGGGG + Intronic
951687125 3:25357337-25357359 CCTTCTCCCACTTTTTGTTGGGG + Intronic
951993222 3:28699253-28699275 CCACCTCTCTCTTCTTGTTGTGG - Intergenic
952402115 3:32972821-32972843 CCAGCTCTTTCTCTTTCTTAGGG - Intergenic
952892384 3:38052275-38052297 CCAGCCTGCTCTCTATGTTGAGG - Intronic
953360991 3:42296543-42296565 GCAACACCCTCTCTTTTTTGTGG + Intergenic
953674666 3:44991550-44991572 GCAACACCCTCTCTTTGGTGTGG - Intronic
954147546 3:48641771-48641793 CCAGCTCCCCATCTTTCCTGCGG - Intronic
954674424 3:52307892-52307914 CCTGCTCCGTCTCTGTGTGGGGG + Intergenic
955191087 3:56762179-56762201 CCAGGTCCCTCACTTTGAGGTGG - Intronic
955319933 3:57967081-57967103 CCAGCTCCTTCTCATTGTTTAGG + Intergenic
956156452 3:66303415-66303437 CTAGCTCCCTCTCTTAGTCTTGG + Intronic
957739961 3:84252598-84252620 CCAGCACCCCCTCTTTATTTGGG + Intergenic
958866941 3:99511738-99511760 CCATCTCTCTCTCTCTGTTTTGG - Intergenic
960966927 3:123111951-123111973 CCAGCTGCCTCTTTTTGTAAAGG + Intronic
963005132 3:140719943-140719965 TGTGCTCCCTCTCTTTGCTGTGG - Intergenic
964993545 3:162844991-162845013 CCAGCTCCCTCTGCTTGCAGGGG - Intergenic
965578552 3:170243798-170243820 CCAGCTACTTCTCTTAGTTCTGG + Intronic
966766737 3:183469921-183469943 CCAGTTTTCTCTCTTTGTTGAGG + Intergenic
970594225 4:17585203-17585225 CCAGCTCCCTCACTTTTTAGAGG + Intronic
973331640 4:48915382-48915404 CCCACTTCCTCTCTTGGTTGGGG - Intergenic
974250564 4:59378202-59378224 CCACCTCTTTCTCTTTTTTGTGG - Intergenic
974977306 4:68906631-68906653 CCAGTTCCCTATCCTGGTTGGGG + Intergenic
975661849 4:76696471-76696493 CCAGTACCTTCTCTTTGTCGTGG + Intronic
978989437 4:115060987-115061009 CCATCACCCACTTTTTGTTGAGG - Intronic
980684557 4:136209818-136209840 CCTCCTCTCTCTCTCTGTTGAGG - Intergenic
982130841 4:152227383-152227405 CCAGTTCCCTCTCTTGTTTGGGG + Intergenic
985546380 5:511498-511520 CCATCTGCCTGTCTTTGGTGTGG - Intronic
985816055 5:2128998-2129020 CCAGCTCGATCCCTTTTTTGAGG + Intergenic
986380717 5:7182832-7182854 CCTGCTACCTCTCTGTTTTGTGG + Intergenic
986709265 5:10476250-10476272 CCAGACCCCTCTATGTGTTGCGG + Intergenic
987741474 5:21914508-21914530 CCATCTCTCTCTCTTTGTATGGG - Intronic
988227257 5:28428100-28428122 CCACCTCCGTCTCTTTACTGTGG - Intergenic
988586015 5:32508163-32508185 CCACCTCCGACTCTTTGTTGTGG + Intergenic
989139868 5:38191679-38191701 CCAGCTCTGTCACTTTGTTCTGG + Intergenic
989472028 5:41831325-41831347 CTAGCTTCCTCTCTTTCTTGAGG + Intronic
989782107 5:45279931-45279953 CCAACTCCCTCACTTTCCTGAGG + Intronic
990999880 5:61772068-61772090 CCAGCTCCCTCTCTCAGTATTGG - Intergenic
991477682 5:67040687-67040709 CCAGCTCCATCTCTTAGCTGTGG + Intronic
995430335 5:112067641-112067663 CCACCTGTCTCTCTTTGATGAGG + Intergenic
995929813 5:117426292-117426314 CCAGCTCTCTCTCTTTTTTAAGG + Intergenic
998278789 5:140784332-140784354 CCACCTCCCCCTCTCTGCTGGGG - Intergenic
999113043 5:149138455-149138477 CCCGCTGCCTCTGATTGTTGTGG + Intergenic
999293067 5:150440313-150440335 TCAGCTCCCTCACTTTGTTTGGG + Intergenic
1000907438 5:166979381-166979403 CCCTCTCTCTCTCTTTCTTGAGG + Intergenic
1001674274 5:173499439-173499461 CCTGCTCCCTCTCTCTGGTCAGG - Intergenic
1001675311 5:173507341-173507363 CCAGCTCCCTCCCTGTGGGGTGG - Intergenic
1002204060 5:177550760-177550782 CCTGCCCCCTCTCTTAGGTGAGG + Intronic
1006020878 6:31116871-31116893 CCAGCTCCCACTCTGTGTCAGGG - Exonic
1006899028 6:37488233-37488255 CCAGATGCCTCTTTTAGTTGTGG + Intronic
1007110961 6:39313439-39313461 CGAGCCCCCTCTCTGCGTTGAGG + Intronic
1007283174 6:40727482-40727504 CCATCTCCCCCTAGTTGTTGGGG + Intergenic
1008348177 6:50455166-50455188 CCTGCTCCCACTCTTGGCTGCGG + Intergenic
1009271907 6:61624638-61624660 CCAGCTGCCTCTGGGTGTTGTGG - Intergenic
1012358339 6:98344844-98344866 TCTGCTCCCTTTCTTTGTTCTGG - Intergenic
1012662859 6:101924753-101924775 CCATGTCCCACTCTTTGCTGGGG + Intronic
1015625836 6:135180880-135180902 CCAGCTCCCACTCACTGTCGCGG - Intergenic
1015842224 6:137488378-137488400 CCAGCTGCGTCTCTTCGCTGGGG - Intergenic
1016239235 6:141909116-141909138 CCAACACCCTCCCCTTGTTGTGG + Intergenic
1017543439 6:155426549-155426571 GCAGCTCCCTCTCTTCCTTCAGG - Intronic
1017984340 6:159429946-159429968 CCTGCTACCTATCCTTGTTGAGG + Intergenic
1018338105 6:162817481-162817503 GCAGCTTCGTCTCTTTCTTGTGG + Intronic
1019561626 7:1662174-1662196 CCTGCGCCCTCTCTCTGCTGAGG - Intergenic
1019866962 7:3721170-3721192 ACTGTTCCCTCTCTTGGTTGTGG + Intronic
1020028202 7:4914523-4914545 CCAGCTCCCTCTCTTTGTTGGGG - Intronic
1021283710 7:18752641-18752663 ACAATTTCCTCTCTTTGTTGTGG + Intronic
1022801503 7:33781141-33781163 CCAGCTCCCTCTATGGGGTGAGG - Intergenic
1023168365 7:37365383-37365405 CAAGCTCCCTCTAGTTGGTGTGG + Intronic
1028664300 7:93322780-93322802 CCAGTTCTGTCTCTTTTTTGTGG - Intronic
1029280675 7:99433467-99433489 CAACCTCCCTCTCTCTGCTGAGG - Intronic
1029297832 7:99555606-99555628 CCAGCTTCCACTTTTTATTGGGG - Intronic
1029599387 7:101554835-101554857 CCTGCTCCTTCTCTGAGTTGGGG + Intronic
1034081154 7:148278866-148278888 CCAGCTTTCTCACTTTGTTAAGG - Intronic
1034594617 7:152177927-152177949 CCAGATCCCTGTATTTGCTGAGG + Exonic
1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG + Intergenic
1037501768 8:19493278-19493300 CCAGTTTCCACTCTTTTTTGGGG + Intronic
1037899804 8:22681237-22681259 CCAGCTCCCTCTTTTGTCTGTGG - Intergenic
1040021263 8:42743344-42743366 CCAGCTCAATCTTTTTGTTAGGG + Intergenic
1041934799 8:63322924-63322946 CCATCTCTCTCTATTTCTTGTGG + Intergenic
1043496496 8:80806700-80806722 ACAGCTCCCACTCTTGGTTGTGG - Intronic
1049011826 8:139892346-139892368 CCAGCTGCCTCTCTCTGGAGAGG + Intronic
1051692051 9:19725225-19725247 CGAGCACCATTTCTTTGTTGTGG - Intronic
1051777796 9:20655454-20655476 CCATCTCTCTCCCTTTGTTCAGG - Intergenic
1052201511 9:25787176-25787198 CCAGTTCTGTCTCTTGGTTGAGG + Intergenic
1059458943 9:114417516-114417538 CCAGCTCTCGCTGTTTATTGGGG + Intronic
1061163289 9:128908382-128908404 CCAGCGTCCACTCGTTGTTGAGG - Exonic
1061644310 9:131987871-131987893 CCCGGTTCCTCTCTTAGTTGGGG + Intronic
1061979110 9:134089948-134089970 CCAGCTGCCTCTCGTTCCTGGGG + Intergenic
1186114876 X:6294698-6294720 CCATCTCTCTCTCTTTTTGGTGG + Intergenic
1186303556 X:8227999-8228021 CAAGCCCCATCTCTTTTTTGTGG + Intergenic
1187766065 X:22643702-22643724 CCAGCTCCATCACTTTGAGGGGG - Intergenic
1187917748 X:24171209-24171231 CCAGCTTTCTCTTTTTTTTGTGG + Intronic
1189336088 X:40171765-40171787 CCGGCTCCCTCTCCGGGTTGCGG - Intronic
1189453354 X:41160507-41160529 CCACCTCCCTTTTTTTGTTTAGG - Intronic
1190916030 X:54811751-54811773 CCAGCTCCATCGCTATGCTGAGG + Intronic
1192828211 X:74721357-74721379 CCTGCTCCCTATCTTTGTCATGG - Intergenic
1194071254 X:89328799-89328821 TCATCTCCCTCTCTGTGTGGTGG - Intergenic
1198506471 X:137306397-137306419 ACATCTCCCAGTCTTTGTTGGGG + Intergenic
1199557024 X:149120624-149120646 CCAGGTCCCTGTCTGTCTTGTGG + Intergenic
1200725486 Y:6664537-6664559 TCACCTCCCTCTCTGTGTGGTGG - Intergenic
1200763651 Y:7062555-7062577 CCTGCTCCCTGTCTTGCTTGGGG + Intronic
1201223083 Y:11790071-11790093 ACAGTTTCCTCTTTTTGTTGTGG + Intergenic
1201644446 Y:16213798-16213820 CCAGCTCTTTCTCTTTCTCGGGG + Intergenic
1201658369 Y:16371523-16371545 CCAGCTCTTTCTCTTTCTCGGGG - Intergenic