ID: 1020034050

View in Genome Browser
Species Human (GRCh38)
Location 7:4953135-4953157
Sequence CTGTAGGGATGGAGGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020034050_1020034056 -6 Left 1020034050 7:4953135-4953157 CCCTGTTTCCTCCATCCCTACAG 0: 1
1: 0
2: 0
3: 25
4: 386
Right 1020034056 7:4953152-4953174 CTACAGTTCCCCATCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020034050 Original CRISPR CTGTAGGGATGGAGGAAACA GGG (reversed) Intronic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900993146 1:6107036-6107058 ATGGAGGGATGGAGGAATGATGG + Intronic
900993418 1:6108093-6108115 ATGGAGGGATGGTGGAGACATGG + Intronic
900993427 1:6108131-6108153 ATGGAGGGATGGAGGAATGATGG + Intronic
902132316 1:14273070-14273092 TTGTTGGGCTGGATGAAACACGG + Intergenic
902997843 1:20240913-20240935 TTGTTGGGATAGAGGCAACATGG + Intergenic
903670247 1:25031171-25031193 CTGGAGGGATGGAGGATGAAGGG + Intergenic
903791832 1:25898498-25898520 CGCTAGGGATGGAGAAAAGATGG - Intronic
904987476 1:34563750-34563772 CTGTATGGATGGAGAAGTCATGG - Intergenic
908815100 1:68023630-68023652 CTGTAAGGAAGGAGGAACGAAGG + Intergenic
909488956 1:76205427-76205449 CTGTAGGGAATGATGAATCAGGG - Intronic
909912604 1:81279303-81279325 CTGGAAGGATGCAGGAAAGATGG - Intergenic
910511775 1:88014774-88014796 CCGTAAGGATGGAGGAACAAAGG - Intergenic
911800160 1:102126316-102126338 CTGAAGGGAAGGAGGAAATGTGG + Intergenic
912948992 1:114107471-114107493 CTGGAGGCAGGGAGGAAACCAGG + Intronic
913697028 1:121336521-121336543 AGGAAGGGAAGGAGGAAACAAGG - Intronic
914140531 1:144943523-144943545 AGGAAGGGAGGGAGGAAACAAGG + Intronic
914336206 1:146717063-146717085 CTGTATGGAAGGAGGATCCACGG - Intergenic
914931855 1:151942056-151942078 CATTAGGGCTGGAGGAAATAGGG + Intergenic
915148055 1:153807166-153807188 CTCTGGGGATGGAGGAAGCCAGG + Exonic
915304138 1:154968369-154968391 CAGTAGGGAAGGAGGAAATGAGG - Intronic
916336260 1:163674010-163674032 AGGGAGGGATGGAGGAAACTAGG + Intergenic
916779534 1:168009514-168009536 AAGAAGGGATGGAGGAAAGAAGG - Intronic
917363922 1:174208219-174208241 CAGTAAGGTTGGAGGATACAAGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
919757614 1:201075616-201075638 CTGTATGGAGGGAGGATAGAGGG + Intronic
919849745 1:201664684-201664706 CTGGTTGGTTGGAGGAAACATGG + Intronic
920484359 1:206354858-206354880 AGGAAGGGAGGGAGGAAACAAGG - Intronic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
922133801 1:222805658-222805680 CTCTAGGGCTGGAGGAACAAAGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923099495 1:230801057-230801079 CTGTTGGGAAGGAGGAGGCAGGG + Intronic
923199626 1:231698682-231698704 CTGAAGAAATGCAGGAAACAAGG - Intronic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923264499 1:232301065-232301087 CTGTAGGGATGGGGCAGCCAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924461492 1:244263446-244263468 CCGGAGGGAGGGAGGAAAGAAGG + Intergenic
1064289517 10:14020859-14020881 CTGTAGAGGTGGAGGAAAGGGGG + Intronic
1064895300 10:20228632-20228654 CGGAAGGGAGGGAGGAAACAAGG + Intronic
1066373136 10:34834454-34834476 CTGTGGGGTTGTGGGAAACAGGG + Intergenic
1067191052 10:44068727-44068749 CTTTAGGGAAGAAGGACACAGGG + Intergenic
1069904043 10:71721956-71721978 TTGGAAGGATGGAGGAAACCTGG - Intronic
1070475900 10:76828851-76828873 CTGTAGGGAATGAAGAAACATGG + Intergenic
1072100730 10:92226869-92226891 GGGAAGGGATGGAGGGAACAGGG + Intronic
1072800038 10:98386296-98386318 AGGGAGGGAGGGAGGAAACAAGG + Intronic
1074446300 10:113523879-113523901 CTTTATGGATGAAGGAACCAAGG - Intergenic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076454345 10:130579044-130579066 CTGGAGGGAAGCAGGAAAGAGGG - Intergenic
1077433258 11:2526432-2526454 CTGTGGGGAGGGAGGAACCCAGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077742704 11:4864769-4864791 CTGTAGACATGGAGGAGTCAAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078446728 11:11410181-11410203 CTGAAGGGAGAGAGGACACAGGG - Intronic
1079470621 11:20774141-20774163 AGGGAGGGATGGAGGAAAGAAGG - Intronic
1081233844 11:40621150-40621172 CTATATGGATGAAGAAAACAAGG - Intronic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081743216 11:45455396-45455418 CTCTAGGGAAGCAGGAATCAAGG - Intergenic
1083259954 11:61517521-61517543 ATGGAGGGGTGGAGGAAAGAAGG + Intronic
1083977998 11:66139655-66139677 TTGGATGGATGGATGAAACATGG - Intronic
1084455254 11:69264572-69264594 CAGTAAGGAGGGAGGGAACAAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086345372 11:85890694-85890716 CTGAAGGGAAGAGGGAAACATGG - Intronic
1086725614 11:90179591-90179613 CTGCAGTGATGGGGGAAATAAGG + Intronic
1088249135 11:107847708-107847730 CAGGAGGGACAGAGGAAACAGGG + Intronic
1088599337 11:111461408-111461430 CAGGAGGGAGGGAGGAACCAGGG + Intergenic
1088928588 11:114326739-114326761 CTTTATGGATGGAGAAACCAAGG + Intergenic
1091423024 12:359843-359865 AAGGAGGGAGGGAGGAAACAAGG + Intronic
1091935054 12:4428322-4428344 GTGAAGGGAGGGAGGAAACTCGG + Intronic
1094031056 12:26011441-26011463 CTGCAGGCAGGGAGGAAGCAAGG - Intronic
1094174082 12:27524117-27524139 CTGCAGGGAGGGAGGAGAGAAGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094298089 12:28930414-28930436 TTGTAGGTATAGAGGAAACAAGG + Intergenic
1094569554 12:31629671-31629693 CTCTATGGTAGGAGGAAACAAGG - Intergenic
1096430511 12:51539114-51539136 CTGCACTGATGGAAGAAACATGG - Intergenic
1096717288 12:53499275-53499297 CTGTGGGGATGGAGGAACTGGGG - Intronic
1098321362 12:69247146-69247168 TTGAAGGGAGGGAGGAGACAGGG + Intronic
1099020605 12:77399463-77399485 AGGTAAGAATGGAGGAAACAGGG - Intergenic
1101084984 12:101226628-101226650 CTGTAAGGCTGGAGGAAACCAGG - Intergenic
1101382425 12:104225789-104225811 ATGAAGGGATGGAGGAATCCAGG - Intronic
1101590297 12:106119542-106119564 CTGTAGGGAAGCTGGAAAAATGG + Intronic
1101720557 12:107346892-107346914 CTGCAGGGAATGAAGAAACAGGG + Intronic
1101925180 12:108965946-108965968 ATGGAGGGAGGGAGGAAAGAAGG - Intronic
1101941757 12:109104514-109104536 CTGATGGGATGGAGGATTCAAGG - Intronic
1102503663 12:113370306-113370328 CTCTAGGGATAGAGGAGGCAGGG + Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103568138 12:121827350-121827372 CTGATGGGATGGAGGAGGCAGGG + Intronic
1103862151 12:124024085-124024107 TTGTAGAGATGGAGGTAGCAGGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104646757 12:130502916-130502938 TGGTAGGGATGGAGGGGACAGGG + Intronic
1104668759 12:130666657-130666679 GGGGAGGGATGGAGGAAAGAGGG + Intronic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1107049107 13:36028510-36028532 CTGGAGGGCGGGAGGAAGCAAGG - Intronic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111419860 13:87998515-87998537 CTGCAGGGATGGAGCCATCATGG + Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1111873428 13:93863277-93863299 CTGTAGGGAGAGAGAAACCATGG - Intronic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1113081615 13:106526122-106526144 CTGCAGGGCTTGAGAAAACAGGG - Intronic
1114211663 14:20621064-20621086 CAGTAGGGAGGGAGGAAACTTGG - Intergenic
1114411366 14:22503682-22503704 CTGGAGGGAAGGAAGAAAAATGG + Intergenic
1114630570 14:24157040-24157062 CAGTAGGGATGAAGGAAAAGGGG + Intronic
1114674418 14:24430939-24430961 CTGGAGGGATGGGGGAGAGAAGG - Intronic
1115450852 14:33545670-33545692 CTGAAGGAATTGAGAAAACAAGG + Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1115846006 14:37535626-37535648 CTGTAGGGATGGATTATAAAAGG - Intronic
1116630167 14:47320580-47320602 ATGGAGGGATGGAGGAAAAGAGG - Intronic
1116910476 14:50458138-50458160 CTGTACGGATGAAGGAAAATGGG - Intronic
1117402793 14:55372717-55372739 TTGGAGGGAGGGAGGAAAGAAGG - Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1119949637 14:78730985-78731007 CTGAAGGGAGGGAGGAAGAAAGG - Intronic
1120635554 14:86946374-86946396 CTGGAGGGAGGGAGGAAGGAAGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120883368 14:89432502-89432524 CTGTAAGGGTGGTGGAAAGATGG - Intronic
1121982817 14:98469413-98469435 ATGTAGGGATGGAGGAAGCCTGG + Intergenic
1122147480 14:99700214-99700236 CTGAAGGGAGAGAGGAAAAAGGG + Intronic
1202834214 14_GL000009v2_random:65785-65807 GTGTAGGGGTGGAAGAAAAAAGG + Intergenic
1124711880 15:32020089-32020111 AAGGAGGGAGGGAGGAAACATGG + Intergenic
1124803680 15:32860097-32860119 CAGGAGGGAGGGAGGAAAGAAGG + Intronic
1125185358 15:36923849-36923871 CTGTATGGAGGGAGGTGACATGG - Intronic
1125398526 15:39275387-39275409 CTGAAGAGATGGAAGAAACAAGG - Intergenic
1125934806 15:43625911-43625933 GTGTAGTGTTGGAGGAAAAAAGG + Intergenic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1129132009 15:73507996-73508018 CTGTAGGGATGCACCAAAAATGG - Intronic
1129932133 15:79420469-79420491 CTGTAGGCTTGGGGGAAACTTGG + Intronic
1131077391 15:89503893-89503915 CTGTATGGATGGGGAAACCAAGG - Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132755966 16:1485692-1485714 CCGTGGTGATGGAAGAAACATGG + Intergenic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133782210 16:8948199-8948221 CTGGTGGGAGGGAGGAATCAAGG - Intronic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1136128615 16:28204054-28204076 CTTTAGGGAAGGAGTAAACTAGG - Intronic
1136540735 16:30926467-30926489 CAGTAGGGATCGGGGAAGCATGG + Intronic
1137288570 16:47036570-47036592 ATCTAGGGATGGTGAAAACAAGG - Intergenic
1138639061 16:58368314-58368336 TTGGAGGGATGGAGGAGAAAAGG + Intronic
1139641443 16:68294525-68294547 CTGTAGGGAAGGGGGGAGCAGGG + Intronic
1139997413 16:70994152-70994174 CTGTATGGAAGGAGGATCCACGG + Intronic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1140187033 16:72783642-72783664 TTGGAAGGATGGAGGAAAGATGG + Exonic
1141024925 16:80537484-80537506 ATGCAGGGAAGGAGGAAAGATGG + Intergenic
1142252840 16:89000648-89000670 CTGGAGGGATGGCGGACACGTGG - Intergenic
1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144406594 17:14957939-14957961 CCGTAGCAATGGAGGAACCACGG + Intergenic
1145869274 17:28260149-28260171 GTGTGGAGAAGGAGGAAACAGGG - Intergenic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1146768796 17:35549074-35549096 CTGTAAGGACGGAAAAAACAGGG + Intronic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1151387159 17:73762044-73762066 TTGGAGGGCTGGTGGAAACACGG + Intergenic
1152229092 17:79105807-79105829 TTGGAGGGAGGGAAGAAACACGG + Intronic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155724032 18:29056678-29056700 ATGTAGGAATGGAGAAAGCAGGG + Intergenic
1156418793 18:36927839-36927861 AGGAAGGGAGGGAGGAAACAAGG + Intronic
1158791421 18:60784654-60784676 CTGCAGGGATGGAGCCATCATGG + Intergenic
1159086320 18:63795733-63795755 CTCTAGTGAGAGAGGAAACATGG + Intronic
1159283242 18:66314468-66314490 ATGGAGGGAAGGAGGAATCAGGG - Intergenic
1159320767 18:66845048-66845070 CTATAGGGAAGAAGGAAGCAGGG + Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1161250087 19:3275781-3275803 CTGGAGGGAGGGAGGAATCCCGG + Intronic
1161652417 19:5493379-5493401 TTGGAGGGATGGAGGATTCAGGG + Intergenic
1162853449 19:13449809-13449831 GTCTAGGGAGGGAGAAAACAGGG + Intronic
1162948085 19:14055426-14055448 CTGCAGAGATGGCGGAGACAAGG + Intronic
1165446597 19:35860203-35860225 CTCCTGGGATGGAGGAACCAGGG + Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1167089301 19:47332348-47332370 CGGTAAGGATGGAGGCTACAAGG + Exonic
1167318488 19:48780672-48780694 CTGTAGGGCTGGACGCTACAAGG - Intergenic
1167527497 19:49994143-49994165 CTGGAGGGATGGACGTACCAAGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
924964293 2:60776-60798 ACATAGGGATGCAGGAAACATGG + Intergenic
927467066 2:23345277-23345299 CTGGAGAGATAGAGGAAACTTGG - Intergenic
929438335 2:41946100-41946122 CTGGAGGGGAGGAGGAGACAGGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929741768 2:44609746-44609768 ATGGAGGGATGGAGGAGAAATGG + Intronic
930338271 2:50078595-50078617 CTGAAGGGACAAAGGAAACATGG - Intronic
930417753 2:51110496-51110518 CTTAAGGGATGGAAGAATCAAGG + Intergenic
932432964 2:71686431-71686453 CTGGAGGGAGGGAGGAGACAGGG - Intronic
932447129 2:71787868-71787890 AGCTAGGGATGGAGGGAACAAGG - Intergenic
933103048 2:78284300-78284322 CTTTAGGGTTGCAGGAAACATGG - Intergenic
933191535 2:79339117-79339139 CTGTAGGGAGAGAGTGAACAGGG + Intronic
933634939 2:84698563-84698585 CTGATGTGATGGAGGACACATGG - Intronic
934136182 2:88998533-88998555 CGGTAGGGATAGAGGAAATGGGG - Intergenic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
934532865 2:95106458-95106480 CTGTAGGGAGAAAAGAAACAGGG + Intronic
935170323 2:100606511-100606533 CTGCAGAGGTGGAGGAATCACGG + Intergenic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
939126000 2:138178280-138178302 CTGTATGGCTGCAGGAAATAAGG + Intergenic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
940159552 2:150696840-150696862 CAGGAGGGAGGGAGGAAAGAAGG + Intergenic
940692555 2:156937445-156937467 AGGGAGGGATGGAGGAAAAAAGG + Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
942371944 2:175294764-175294786 ATGTAGAGATGGAGGAGGCACGG - Intergenic
942758429 2:179369355-179369377 CAGTAGGGATGGAGGACCGAGGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1169968927 20:11247893-11247915 CTGTATTGATGGAGGAAATGGGG - Intergenic
1171820351 20:29830928-29830950 TTGAAGGGATGGTGGAGACAAGG + Intergenic
1172169817 20:32922695-32922717 CTGAAGGAAGCGAGGAAACATGG + Intronic
1172323421 20:34015801-34015823 CTGTAGGGATGGGGAAAAGTAGG - Intronic
1172614302 20:36273477-36273499 TTTTATAGATGGAGGAAACAAGG + Intergenic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173722621 20:45272825-45272847 CTGGGGGGATGGAGAAAGCATGG - Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1179286910 21:39985347-39985369 ATGCAGGGATGGAGGAAGAAGGG - Intergenic
1179364362 21:40742415-40742437 CTGTAGGGCTGGAGAAGCCAAGG + Intronic
1179575381 21:42305252-42305274 ATCTAGGGATGGAGAAACCAGGG - Intergenic
1180324353 22:11355633-11355655 TTGAAGGGATGGTGGAGACAAGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181862265 22:25828328-25828350 CTGTAGGGGTGGACACAACAGGG - Intronic
1183165974 22:36147705-36147727 CTGAAAGGATGAAGGAAACCAGG + Intronic
1183269156 22:36849947-36849969 CTGTAGGGATGGAGGAGGAGAGG + Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
951928587 3:27937986-27938008 GTATAGGGAAGGAGGAAAAATGG + Intergenic
951953520 3:28228298-28228320 CTCTAGGCGTGGAGAAAACATGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
953927222 3:46988613-46988635 CAGGAGGGATGCAGTAAACAGGG - Intronic
954305289 3:49722359-49722381 CTGTAGGGAGGGATGCATCAGGG + Intronic
954916295 3:54151016-54151038 ATGTAGGGATAGAGGATAGATGG + Intronic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
958821213 3:98975904-98975926 CTGTTGGGAGGGTGGAATCAGGG + Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
959416179 3:106078743-106078765 CTATAGGGAGGGAGGAAGGAAGG - Intergenic
961719590 3:128884083-128884105 CTGTAGGGATCGATGAGACTTGG + Intronic
962356399 3:134698061-134698083 CTGATGGGATGGTGGAGACATGG + Intronic
962506114 3:136047953-136047975 GGGTAGGGATGGAGGGAGCAAGG + Intronic
963038130 3:141050114-141050136 ATGGATGGATGGAGGAAACCAGG - Intergenic
963074603 3:141334361-141334383 ATGGAGGGAGGGAGGAAAGAAGG - Intronic
963280876 3:143383827-143383849 CTGTTGGGGTGGGGGAAGCAAGG + Intronic
965401880 3:168222167-168222189 ATGTAGGGATAGAGTAAACGTGG + Intergenic
966769623 3:183492229-183492251 CTGAGGAGAGGGAGGAAACACGG + Intronic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967098743 3:186198467-186198489 CTCTAGGGATGGAGCAGAAATGG + Intronic
967461633 3:189754276-189754298 ATGCAAGGATGGAGGAAAGAAGG - Intronic
967685375 3:192410250-192410272 CGGGAGGGAGGGAGGAAAGAAGG - Intronic
968171662 3:196515126-196515148 CTATAGGGAGGGAGCAAGCATGG - Intronic
968869517 4:3234565-3234587 CTGTGGGCATGGAGGACTCAGGG + Intronic
968969575 4:3786608-3786630 CTGCAGGGATGGTGCAAAAAAGG - Intergenic
970423165 4:15923872-15923894 TTTTAGGTATGGAGGCAACATGG - Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
972035506 4:34514586-34514608 CCTTAAGGATAGAGGAAACAAGG - Intergenic
972071945 4:35032123-35032145 ATGTTGGGATGTAGGATACATGG - Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
973555451 4:52077239-52077261 AGGGAGGGATGGAGGGAACAAGG - Intronic
973787843 4:54350330-54350352 CTGTAGGGAAGTAGGAGGCAGGG + Intergenic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976410312 4:84705913-84705935 GTGGAGGGAGGGAGGACACAAGG - Intronic
976948416 4:90799032-90799054 CTGAAGGGAGGCAGGAACCATGG - Intronic
977064962 4:92303840-92303862 CTGGCGGGATGCAGGAAGCAAGG - Intronic
978083697 4:104623966-104623988 ATGTATGGGTAGAGGAAACAAGG + Intergenic
979172915 4:117624413-117624435 CTGAAGGGATGGAGGAATCTGGG + Intergenic
981836348 4:149058854-149058876 CAATAAGGATGGAGGAAAGAGGG - Intergenic
982202816 4:152975745-152975767 ATGTAGGGTTGGAGGAGACTTGG - Exonic
983109105 4:163726037-163726059 ATGTAGGGATGGGGGATATAAGG - Intronic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
984184456 4:176526307-176526329 ATGTGGGGAGGGAGAAAACAGGG + Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985849419 5:2377775-2377797 AGGGAGGGAGGGAGGAAACAAGG + Intergenic
986185627 5:5433840-5433862 CTGTAAGGAGGGAGTAAACTAGG - Intronic
987542804 5:19277026-19277048 CTGCAGGGATGGAGCCATCATGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
989172816 5:38490234-38490256 CTGTATGGATGCAGAAATCAAGG - Exonic
990265122 5:54067041-54067063 AAGTAGTGATTGAGGAAACACGG - Intronic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992829340 5:80579121-80579143 CGGGAGGGAGGGAGGAAAGAAGG + Intergenic
992955884 5:81907616-81907638 TTCTGGGGCTGGAGGAAACAAGG + Intergenic
994716782 5:103331138-103331160 GATTAGGGATGGAGGAAATAGGG + Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995315865 5:110773607-110773629 CTGGAGGGATGGAACAAATATGG - Intergenic
995355982 5:111238200-111238222 CTGGAGAGATGAAGGAAACAGGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
999676501 5:154008927-154008949 CTGTAGGGATGGATTAAAATTGG + Intronic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002708143 5:181176965-181176987 TTGTAGGGATGGCGGAGAAATGG + Intergenic
1003068514 6:2924377-2924399 CTTTAGGTAGTGAGGAAACACGG - Intergenic
1003709787 6:8576425-8576447 AGGTAGGGAGGGAGGAAAGAAGG - Intergenic
1004789632 6:19010469-19010491 ATGTAGAGATAGAGGAAATAAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005821785 6:29604802-29604824 AAGGAGGGATGGAGGGAACATGG + Intronic
1006263525 6:32896144-32896166 CTGCTGGGATGCATGAAACATGG - Intergenic
1008591094 6:52994808-52994830 CTGTAGGGGTGGTGGACACGCGG - Intronic
1009247303 6:61254810-61254832 CTATAGAGATGAAGGAAAAAGGG - Intergenic
1009288461 6:61852982-61853004 GTGTGAAGATGGAGGAAACAGGG - Intronic
1013367943 6:109448964-109448986 CTGTAGGGGAGGAGGAGTCAGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013724591 6:113077998-113078020 CTGCAGGGATGAAGTCAACAAGG + Intergenic
1013996875 6:116319424-116319446 CTATAGGGAATGAGGAAATATGG + Intronic
1014465951 6:121757122-121757144 TTCTAGGGATGGAGTGAACAGGG + Intergenic
1014856808 6:126412031-126412053 GTGGAGGGATGGAGGAAGGAAGG - Intergenic
1016123969 6:140376439-140376461 AGGGAGGGAGGGAGGAAACAAGG - Intergenic
1016124002 6:140376558-140376580 AGGGAGGGAGGGAGGAAACAAGG - Intergenic
1016125528 6:140397838-140397860 CTGCAGGGCTGCAGCAAACATGG + Intergenic
1016701207 6:147056173-147056195 GTGTAGGCAAGGATGAAACAAGG + Intergenic
1017618569 6:156271559-156271581 CTGTAGGGATGGTGGTATCATGG - Intergenic
1017905144 6:158752874-158752896 CAGTAGGGACCCAGGAAACAAGG - Intronic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019476188 7:1245587-1245609 CTTCAAGGATGGAGGAAGCATGG - Intergenic
1019923608 7:4178462-4178484 CTGCAGGGTTGAAGGAAATATGG - Intronic
1020020477 7:4863942-4863964 CTCTAGGGCTGGAAGAAAAAGGG - Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1022566944 7:31413275-31413297 CTTTAGGGATGCAGGAACCCAGG - Intergenic
1023218845 7:37897347-37897369 CTGGAGGGATGGAGACAACAGGG + Intronic
1024773940 7:52759949-52759971 AGGTAGGGAGGGAGGAAAAAGGG + Intergenic
1024780275 7:52839716-52839738 CTGGAGGGAAGAAAGAAACATGG - Intergenic
1025934299 7:66022341-66022363 CTAGAGGGAGGGAGGAAAGAAGG + Intergenic
1026211402 7:68309017-68309039 TAGTAGAGATGGAGGCAACATGG + Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1029930907 7:104370113-104370135 CTCTAAGGATGGAGGAACAAAGG + Intronic
1030744311 7:113146739-113146761 CTATAGAGTTGGAGGAAGCATGG + Intergenic
1032358342 7:131230713-131230735 CTGTAGGGAAGGAAGGCACAGGG - Intronic
1032800422 7:135313161-135313183 TTGCAGGGATGGAGGAAGCCTGG + Intergenic
1032881088 7:136091244-136091266 CGGTAGGATTGGAGGAAACCAGG + Intergenic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1034065817 7:148135898-148135920 AGGGAGGGAGGGAGGAAACAAGG + Intronic
1034584156 7:152074516-152074538 CTGTAGTGATGGAAACAACATGG - Intronic
1034973627 7:155435490-155435512 CTGTCGGGAGGCAGGAATCATGG + Intergenic
1035009900 7:155705790-155705812 CTTTAGGGATACAGAAAACATGG - Intronic
1035062484 7:156079790-156079812 GTGTCTGGATGGAGGAACCAGGG + Intergenic
1036771421 8:11580882-11580904 CTGCAGGAAGGAAGGAAACAGGG + Intergenic
1036799240 8:11777530-11777552 CTGCAGGGAGGGAGGAAAGGGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038342433 8:26697777-26697799 CTGTAGGGATGGTGGACCAAGGG - Intergenic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038923629 8:32113473-32113495 CTGTCAGGCTGGAGGAACCAAGG - Intronic
1039016851 8:33159115-33159137 AAGTAAGGATGGAGGAAAAAAGG - Intergenic
1041924756 8:63224954-63224976 CTTTAAGAATGGAGTAAACAAGG - Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1043735190 8:83731827-83731849 CTGTAATGAAGGAAGAAACATGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045252648 8:100494471-100494493 GTGCAGGGATGGAGAATACAGGG + Intergenic
1045544450 8:103115835-103115857 CTGTAGGGAAGGGGGCTACAGGG - Intergenic
1045598525 8:103685707-103685729 CTGTAGTGATCAAGTAAACATGG - Intronic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1047362956 8:124185549-124185571 GAGCAGGGATGGAGGAAACAGGG + Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1050810554 9:9741265-9741287 CTTTAGTGATAGAAGAAACATGG + Intronic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1051234086 9:14980220-14980242 CTGTATGGATGGATGAATGAAGG + Intergenic
1052223129 9:26051954-26051976 CTCTAGGGGTGAGGGAAACATGG - Intergenic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053649905 9:40156750-40156772 AGGGAGGGAGGGAGGAAACAGGG + Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053755834 9:41307176-41307198 AGGGAGGGAGGGAGGAAACAGGG - Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054330404 9:63748484-63748506 AGGGAGGGAGGGAGGAAACAGGG + Intergenic
1054534676 9:66219453-66219475 AGGGAGGGAGGGAGGAAACAGGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1055303071 9:74902395-74902417 GTGTAAGGATGGAGGGAACCCGG - Intergenic
1056579232 9:87878314-87878336 TTGTAGGGATGGATTCAACAGGG - Intergenic
1057986316 9:99718150-99718172 CTGCAAGGATGAAGGTAACATGG - Intergenic
1058345015 9:103950850-103950872 AGGAAGGGATGGAGGAAGCAAGG + Intergenic
1059028972 9:110668659-110668681 GTGTAGGGCTGGAGGAACAAGGG - Intergenic
1059537640 9:115097437-115097459 CAGAAGGGATGGGGGAATCAGGG + Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1060807742 9:126588149-126588171 CACTAGGGATGGAGGATGCAGGG + Intergenic
1061014220 9:127972648-127972670 CTGGAGGCAGGGAGGCAACAAGG + Intronic
1061919510 9:133775035-133775057 CTGTAGGTTTGCAGGTAACATGG - Exonic
1062127467 9:134871345-134871367 CTGTCGAGAAGGAGGACACAGGG - Intergenic
1202797791 9_KI270719v1_random:141421-141443 AGGGAGGGAGGGAGGAAACAGGG + Intergenic
1203372010 Un_KI270442v1:316204-316226 TTGAAGGGATGGTGGAGACAAGG + Intergenic
1185449610 X:275393-275415 CTGGGGTGAGGGAGGAAACAGGG + Intergenic
1185885285 X:3776860-3776882 CTGTAGCGATGGGGGAAGCTGGG + Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188425550 X:30043089-30043111 CTAGAGGGATGTGGGAAACATGG + Intergenic
1188525498 X:31083611-31083633 CAGAAGGGAAAGAGGAAACATGG + Intergenic
1188598191 X:31926908-31926930 GGGTAGGGCTGGAGGACACAGGG + Intronic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1190595544 X:52050042-52050064 ATGTAGAAAAGGAGGAAACAAGG + Intergenic
1190613280 X:52204031-52204053 ATGTAGAAAAGGAGGAAACAAGG - Intergenic
1192963883 X:76157284-76157306 ATGAAGGGAAGGAGAAAACAGGG + Intergenic
1195119559 X:101736617-101736639 CTGTAGGGATCCAGGAAAGATGG + Intergenic
1195718597 X:107843391-107843413 CTCCAGGGATGGATGGAACATGG + Intronic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197816852 X:130506586-130506608 TTGAAGGGAGGGAGGAAAGAAGG - Intergenic
1199206937 X:145160005-145160027 CTGCAGGGGTGGAGCACACATGG - Intergenic
1199710642 X:150466826-150466848 GTGCAGGGATGGAGGAGGCAGGG - Intronic
1201166757 Y:11215920-11215942 ATGGATGGATGGAGGAAACCTGG - Intergenic
1201550080 Y:15210281-15210303 ATGAAGGGAAGGAGGGAACAAGG + Intergenic